Quick Order

Human PROC1 / Protein C / PROC Gene ORF cDNA clone expression plasmid

  • Human Protein C Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human Protein C cDNA Clone Product Information
NCBI RefSeq:NM_000312.2
RefSeq ORF Size:1386bp
cDNA Description:Full length Clone DNA of Homo sapiens protein C (inactivator of coagulation factors Va and VIIIa).
Gene Synonym:PROC, PROC1
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-PROC
Restriction Site:KpnI + XhoI (5.5kb + 1.39kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for two point mutations: 423 G/T and 459 G/A, neither of which results in any amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PROC qPCR primers for gene expression analysis, HP100260 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human Protein C Gene Plasmid Map
Human Protein C Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Size / Price
Catalog: HG10196-M-N
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Add to CartBulk Discount Inquiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"