After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Prolactin Receptor Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human PRLR cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Prolactin receptor (PRLR) is a single-pass transmembrane receptor belonging to the type â…  cytokine receptor superfamily, and contains two fibronectin type-â…¢ domains. All class 1 ligands activate their respective receptors by clustering mechanisms. Ligand binding results in the transmembrane PRLR dimerization, followed by phosphorylation and activation of the molecules invloved in the signaling pathways, such as Jak-STAT, Ras/Raf/MAPK. The PRLR contains no intrinsic tyrosine kinase cytoplasmic domain but associates with a cytoplasmic tyrosine kinase, JAK2. PRLR mainly serves as the receptor for the pituitary hormone prolactin (PRL), a secreted hormone that affects reproduction and homeostasis in vertebrates. PRLR can be regulated by an interplay of two different mechanisms, PRL or ovarian steroid hormones independently or in combination in a tissue-specific manner. The role of the hormone prolactin (PRL) in the pathogenesis of breast cancer is mediated by its cognate receptor (PRLR). Ubiquitin-dependent degradation of the PRLR that negatively regulates PRL signaling is triggered by PRL-mediated phosphorylation of PRLR on Ser349 followed by the recruitment of the beta-transducin repeats-containing protein (beta-TrCP) ubiquitin-protein isopeptide ligase. which altered PRLR stability may directly influence the pathogenesis of breast cancer.

  • Bole-Feysot C, et al. (1998) Prolactin (PRL) and its receptor: actions, signal transduction pathways and phenotypes observed in PRL receptor knockout mice. Endocr Rev. 19(3): 225-68.
  • Goffin V, et al. (1999) From the molecular biology of prolactin and its receptor to the lessons learned from knockout mice models. Genet Anal. 15(3-5): 189-201.
  • Li Y, et al. (2006) Stabilization of prolactin receptor in breast cancer cells. Oncogene. 25(13): 1896-902.
  • Shao R, et al. (2008) Differences in prolactin receptor (PRLR) in mouse and human fallopian tubes: evidence for multiple regulatory mechanisms controlling PRLR isoform expression in mice. Biol Reprod. 79(4): 748-57.
  • Contact Us
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.