After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
PRRSV PRRSV-N cDNA Clone Product Information
NCBI RefSeq:U87392.3
RefSeq ORF Size:372bp
cDNA Description:Full length Clone DNA of Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N with N terminal His tag.
Gene Synonym:PRRSV-N
Species:PRRSV
Vector:pCMV3-N-His
Plasmid:pCMV3-His-PRRSV2
Restriction Site:KpnI + XbaI (6kb + 0.42kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
PRRSV PRRSV-N Gene Plasmid Map
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, N-His tag on other vectors
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, C-GFPSpark tagVG40337-ACG$325
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40337-ACR$325
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, N-GFPSpark tagVG40337-ANG$325
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40337-ANR$325
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40337-CF$295
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, C-His tagVG40337-CH$295
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, C-Myc tagVG40337-CM$295
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, C-HA tagVG40337-CY$295
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid (Codon Optimized)VG40337-G$95
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, N-Flag tagVG40337-NF$295
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, N-His tagVG40337-NH$295
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, N-Myc tagVG40337-NM$295
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, N-HA tagVG40337-NY$295
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N natural ORF mammalian expression plasmidVG40337-UT$295
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40337-NH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
  • Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N natural ORF mammalian expression plasmid, N-His tag
    Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"