After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Pleiotrophin / PTN / HB-GAM Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human PTN cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

HB-GAM belongs to the pleiotrophin family. During embryonic and early postnatal development, HB-GAM is expressed in the central and peripheral nervous system and also in several non-neural tissues, notably lung, kidney, gut and bone. While in the adult central nervous system, it is expressed in an activity-dependent manner in the hippocampus where it can suppress long term potentiation induction. HB-GAM has a low expression in other areas of the adult brain, but it can be induced by ischemic insults, or targeted neuronal damaged in the entorhinal cortex or in the substantia nigra pars compacta. It is structurally related to midkine and retinoic acid induced heparin-binding protein and has a high affinity for heparin. HB-GAM binds anaplastic lymphoma kinase (ALK) which induces MAPK pathway activation, an important step in the anti-apoptotic signaling of PTN and regulation of cell proliferation. It also functions as a secreted growth factor and induces neurite outgrowth and which is mitogenic for fibroblasts, epithelial, and endothelial cells.

  • Vanderwinden JM, et al. (1992) Cellular distribution of the new growth factor pleiotrophin (HB-GAM) mRNA in developing and adult rat tissues. Anat Embryol. 186(4):387-406.
  • Lauri SE, et al. (1996) Activity-induced enhancement of HB-GAM expression in rat hippocampal slices. Neuroreport. 7(10):1670-4.
  • Pavlov I, et al. (2002) Role of heparin-binding growth-associated molecule (HB-GAM) in hippocampal LTP and spatial learning revealed by studies on overexpressing and knockout mice. Mol Cell Neurosci. 20(2):330-42.
  • Contact Us
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.