Quick Order

Text Size:AAA

Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, N-His-tagged

DatasheetReviewsRelated ProductsProtocols
P. falciparum AMA1 cDNA Clone Product Information
NCBI RefSeq:XM_001347979.1
RefSeq ORF Size:1635bp
cDNA Description:Full length Clone DNA of Plasmodium falciparum (strain 3D7) apical membrane antigen 1 (extracellular domain, ECD) with N terminal His tag.
Gene Synonym:AMA1
Species:P. falciparum
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, N-His-tagged on other vectors
Plasmodium falciparum (strain 3D7) AMA1 (Codon Optimized) ORF mammalian expression plasmid, C-GFPSpark tagVG40296-ACG$345
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40296-ACR$345
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, C-FLAG-taggedVG40296-CF$315
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, C-His-taggedVG40296-CH$315
Plasmodium falciparum (strain 3D7) AMA1 (extracellular domain, ECD) ORF mammalian expression plasmid, C-Myc tagVG40296-CM$315
Plasmodium falciparum (strain 3D7) AMA1 (extracellular domain, ECD) ORF mammalian expression plasmid, C-HA tagVG40296-CY$315
Plasmodium falciparum (strain 3D7) AMA1 (extracellular domain, ECD) natural ORF mammalian expression plasmidVG40296-G$115
Plasmodium falciparum (strain 3D7) AMA1 (extracellular domain, ECD) ORF mammalian expression plasmid, N-Flag tagVG40296-NF$315
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, N-His-taggedVG40296-NH$315
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, N-Myc-taggedVG40296-NM$315
Plasmodium falciparum (strain 3D7) AMA1 (extracellular domain, ECD) ORF mammalian expression plasmid, N-HA tagVG40296-NY$315
Plasmodium falciparum (strain 3D7) AMA1 (extracellular domain, ECD) natural ORF mammalian expression plasmidVG40296-UT$315
 Learn more about expression Vectors
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"