After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Plasmodium falciparum (strain 3D7) AMA1 (extracellular domain, ECD) ORF mammalian expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
P. falciparum AMA1 cDNA Clone Product Information
NCBI RefSeq:XM_001347979.1
RefSeq ORF Size:1635bp
cDNA Description:Full length Clone DNA of Plasmodium falciparum (strain 3D7) apical membrane antigen 1 (extracellular domain, ECD) with C terminal HA tag.
Gene Synonym:AMA1
Species:P. falciparum
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Plasmodium falciparum (strain 3D7) AMA1 (extracellular domain, ECD) ORF mammalian expression plasmid, C-HA tag on other vectors
Plasmodium falciparum (strain 3D7) AMA1 (Codon Optimized) ORF mammalian expression plasmid, C-GFPSpark tagVG40296-ACG$345
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40296-ACR$345
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, C-FLAG-taggedVG40296-CF$315
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, C-His-taggedVG40296-CH$315
Plasmodium falciparum (strain 3D7) AMA1 (extracellular domain, ECD) ORF mammalian expression plasmid, C-Myc tagVG40296-CM$315
Plasmodium falciparum (strain 3D7) AMA1 (extracellular domain, ECD) ORF mammalian expression plasmid, C-HA tagVG40296-CY$315
Plasmodium falciparum (strain 3D7) AMA1 (extracellular domain, ECD) natural ORF mammalian expression plasmidVG40296-G$115
Plasmodium falciparum (strain 3D7) AMA1 (extracellular domain, ECD) ORF mammalian expression plasmid, N-Flag tagVG40296-NF$315
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, N-His-taggedVG40296-NH$315
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, N-Myc-taggedVG40296-NM$315
Plasmodium falciparum (strain 3D7) AMA1 (extracellular domain, ECD) ORF mammalian expression plasmid, N-HA tagVG40296-NY$315
Plasmodium falciparum (strain 3D7) AMA1 (extracellular domain, ECD) natural ORF mammalian expression plasmidVG40296-UT$315
 Learn more about expression Vectors
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"