Pin1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10282-M-F

NOT AVAILABLE

Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Pin1 Reagents
CRO Services

All Pin1 Reagents
Pin1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
492 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human peptidylprolyl cis/trans isomerase, NIMA-interacting 1 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
KpnI + XhoI (5.4kb + 0.54kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Pin1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Pin1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
DOD cDNA ORF Clone, Human;UBL5 cDNA ORF Clone, Human
Pin1 Background Information

Peptidyl-prolyl cis-trans isomerase Pin1, also known as Peptidyl-prolyl cis-trans isomerase NIMA-interacting 1, Rotamase Pin1 and PIN1, peptidyl-prolyl cis/trans isomerase (PPIase), is a nucleus protein. PIN1 is a peptidyl-prolyl isomerase that can alter the conformation of phosphoproteins and so affect protein function and/or stability. PIN1 regulates a number of proteins important for cell-cycle progression and is presumed to operate as a molecular timer of this important process. PIN1 is an essential PPIase that regulates mitosis presumably by interacting with NIMA and attenuating its mitosis-promoting activity. PIN1 displays a preference for an acidic residue N-terminal to the isomerized proline bond. Alterations in the level of PIN1 can influence hyperproliferative diseases such as cancer. PIN1 has been implicated in multiple aspects of cell cycle regulation. It has been suggested that PIN1 function is required for both normal mitotic progression and reentry into the cell cycle from quiescence. PIN1 is also a target of several oncogenic pathways and is overexpressed in human breast cancer. Its overexpression can lead to upregulation of cyclin-D1 and transformation of breast epithelial cells in collaboration with the oncogenic pathways. PIN1 plays a pivotal role in breast development and may be a promising new anticancer target. Pin1 activity regulates the outcome of proline-directed kinase (e.g. MAPK, CDK or GSK3) signalling and consequently regulates cell proliferation (in part through control of cyclin D1 levels and stability) and cell survival. Recent data also implicate Pin1 as playing an important role in immune responses, at least in part by increasing the stability of cytokine mRNAs by influencing the protein complexes to which they bind.

Full Name
peptidylprolyl cis/trans isomerase, NIMA-interacting 1
References
  • Liou YC, et al. (2003) Role of the prolyl isomerase Pin1 in protecting against age-dependent neurodegeneration. Nature. 424(6948): 556-61.
  • Ryo A, et al. (2001) Pin1 regulates turnover and subcellular localization of beta-catenin by inhibiting its interaction with APC. Nat Cell Biol. 3(9): 793-801.
  • Geldner N, et al. (2001) Auxin transport inhibitors block PIN1 cycling and vesicle trafficking. Nature. 413(6854): 425-8.
  • Pin1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Pin1 cDNA ORF Clone, Rat, untagged RG83912-UT
    Pin1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83912-ACGLN
    Pin1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG83912-ACG
    Pin1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG83912-ANG
    Pin1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG83912-ACR
    Pin1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG83912-ANR
    Pin1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG83912-CF
    Pin1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG83912-NF
    Pin1 cDNA ORF Clone, Rat, C-His tag RG83912-CH
    Pin1 cDNA ORF Clone, Rat, N-His tag RG83912-NH
    Pin1 cDNA ORF Clone, Rat, C-HA tag RG83912-CY
    Pin1 cDNA ORF Clone, Rat, N-HA tag RG83912-NY
    Pin1 cDNA ORF Clone, Rat, C-Myc tag RG83912-CM
    Pin1 cDNA ORF Clone, Rat, N-Myc tag RG83912-NM

    Pin1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Pin1 cDNA ORF Clone in Cloning Vector, Mouse MG53818-U
    Pin1 cDNA ORF Clone, Mouse, untagged MG53818-UT
    Pin1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53818-ACGLN
    Pin1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53818-ACG
    Pin1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53818-ANG
    Pin1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53818-ACR
    Pin1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53818-ANR
    Pin1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53818-CF
    Pin1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53818-NF
    Pin1 cDNA ORF Clone, Mouse, C-His tag MG53818-CH
    Pin1 cDNA ORF Clone, Mouse, N-His tag MG53818-NH
    Pin1 cDNA ORF Clone, Mouse, C-HA tag MG53818-CY
    Pin1 cDNA ORF Clone, Mouse, N-HA tag MG53818-NY
    Pin1 cDNA ORF Clone, Mouse, C-Myc tag MG53818-CM
    Pin1 cDNA ORF Clone, Mouse, N-Myc tag MG53818-NM

    Pin1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Pin1 cDNA ORF Clone in Cloning Vector, Human HG10282-M
    Pin1 cDNA ORF Clone, Human, untagged HG10282-UT
    Pin1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10282-ACGLN
    Pin1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10282-ACG
    Pin1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10282-ANG
    Pin1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10282-ACR
    Pin1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10282-ANR
    Pin1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10282-CF
    Pin1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10282-NF
    Pin1 cDNA ORF Clone, Human, C-His tag HG10282-CH
    Pin1 cDNA ORF Clone, Human, N-His tag HG10282-NH
    Pin1 cDNA ORF Clone, Human, C-HA tag HG10282-CY
    Pin1 cDNA ORF Clone, Human, N-HA tag HG10282-NY
    Pin1 cDNA ORF Clone, Human, C-Myc tag HG10282-CM
    Pin1 cDNA ORF Clone, Human, N-Myc tag HG10282-NM
    Pin1 qPCR Primer Pairs, Human HP100328
    info info
    添加购物车成功! 添加购物车失败!