Quick Order

Human Pin1 Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Human PIN1 cDNA Clone Product Information
    NCBI RefSeq:
    RefSeq ORF Size:
    cDNA Description:
    Gene Synonym:
    Species:Human
    Vector:
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with Pin1 qPCR primers for gene expression analysis, HP100328 )
    Promoter:
    Application:
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:
    Shipping_carrier:
    Storage:
    pCMV/hygro Vector Information
     
    Vector Name pCMV/hygro
    Vector Size 5657bp
    Vector Type Mammalian Expression Vector
    Expression Method Constiutive ,Stable / Transient
    Promoter CMV
    Antibiotic Resistance Ampicillin
    Selection In Mammalian Cells Hygromycin
    Protein Tag None
    Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)


    Schematic of pCMV/hygro Multiple Cloning Sites
    Product nameProduct name
    Background

    Peptidyl-prolyl cis-trans isomerase Pin1, also known as Peptidyl-prolyl cis-trans isomerase NIMA-interacting 1, Rotamase Pin1 and PIN1, peptidyl-prolyl cis/trans isomerase (PPIase), is a nucleus protein. PIN1 is a peptidyl-prolyl isomerase that can alter the conformation of phosphoproteins and so affect protein function and/or stability. PIN1 regulates a number of proteins important for cell-cycle progression and is presumed to operate as a molecular timer of this important process. PIN1 is an essential PPIase that regulates mitosis presumably by interacting with NIMA and attenuating its mitosis-promoting activity. PIN1 displays a preference for an acidic residue N-terminal to the isomerized proline bond. Alterations in the level of PIN1 can influence hyperproliferative diseases such as cancer. PIN1 has been implicated in multiple aspects of cell cycle regulation. It has been suggested that PIN1 function is required for both normal mitotic progression and reentry into the cell cycle from quiescence. PIN1 is also a target of several oncogenic pathways and is overexpressed in human breast cancer. Its overexpression can lead to upregulation of cyclin-D1 and transformation of breast epithelial cells in collaboration with the oncogenic pathways. PIN1 plays a pivotal role in breast development and may be a promising new anticancer target. Pin1 activity regulates the outcome of proline-directed kinase (e.g. MAPK, CDK or GSK3) signalling and consequently regulates cell proliferation (in part through control of cyclin D1 levels and stability) and cell survival. Recent data also implicate Pin1 as playing an important role in immune responses, at least in part by increasing the stability of cytokine mRNAs by influencing the protein complexes to which they bind.

    References
  • Liou YC, et al. (2003) Role of the prolyl isomerase Pin1 in protecting against age-dependent neurodegeneration. Nature. 424(6948): 556-61.
  • Ryo A, et al. (2001) Pin1 regulates turnover and subcellular localization of beta-catenin by inhibiting its interaction with APC. Nat Cell Biol. 3(9): 793-801.
  • Geldner N, et al. (2001) Auxin transport inhibitors block PIN1 cycling and vesicle trafficking. Nature. 413(6854): 425-8.
  • Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"