PGD cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10393-M-F
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PGD Reagents
CRO Services

All PGD Reagents
PGD cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1452 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human phosphogluconate dehydrogenase with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
HindIII + XhoI (5.4kb + 1.5kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PGD cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PGD cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human EG-VEGF / prokineticin-1 Gene Plasmid Map 7151
PGD cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
6PGD cDNA ORF Clone, Human
PGD Background Information
Full Name
phosphogluconate dehydrogenase
References
  • Baillet A, et al. (2011) Coupling of 6-phosphogluconate dehydrogenase with NADPH oxidase in neutrophils: Nox2 activity regulation by NADPH availability. FASEB J. 25(7): 2333-43.
  • Rho HK, et al. (2005) Transcriptional regulation of mouse 6-phosphogluconate dehydrogenase by ADD1/SREBP1c. Biochem Biophys Res Commun. 332(1): 288-96.
  • Broedel SE, et al. (1990). Genetic tagging, cloning, and DNA sequence of the Synechococcus sp. strain PCC 7942 gene (gnd) encoding 6-phosphogluconate dehydrogenase. J Bacteriol. 172 (7): 4023-31.
  • Adams MJ, et al. (1983). The three dimensional structure of sheep liver 6-phosphogluconate dehydrogenase at 2.6 A resolution. EMBO J. 2 (6): 1009-14.
  • PGD cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PGD cDNA ORF Clone in Cloning Vector, Rat RG8A6956-U
    PGD Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A6956-ACGLN

    PGD cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PGD cDNA ORF Clone in Cloning Vector, Mouse MG53165-G
    PGD cDNA ORF Clone, Mouse, untagged MG53165-UT
    PGD Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53165-ACGLN
    PGD cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53165-ACG
    PGD cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53165-ANG
    PGD cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53165-ACR
    PGD cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53165-ANR
    PGD cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53165-CF
    PGD cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53165-NF
    PGD cDNA ORF Clone, Mouse, C-His tag MG53165-CH
    PGD cDNA ORF Clone, Mouse, N-His tag MG53165-NH
    PGD cDNA ORF Clone, Mouse, C-HA tag MG53165-CY
    PGD cDNA ORF Clone, Mouse, N-HA tag MG53165-NY
    PGD cDNA ORF Clone, Mouse, C-Myc tag MG53165-CM
    PGD cDNA ORF Clone, Mouse, N-Myc tag MG53165-NM

    PGD cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PGD cDNA ORF Clone in Cloning Vector, Human HG10393-M
    PGD cDNA ORF Clone, Human, untagged HG10393-UT
    PGD cDNA ORF Clone, Human, C-GFPSpark® tag HG10393-ACG
    PGD Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10393-ACGLN
    PGD cDNA ORF Clone, Human, N-GFPSpark® tag HG10393-ANG
    PGD cDNA ORF Clone, Human, C-OFPSpark® tag HG10393-ACR
    PGD cDNA ORF Clone, Human, N-OFPSpark® tag HG10393-ANR
    PGD cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10393-CF
    PGD cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10393-NF
    PGD cDNA ORF Clone, Human, C-His tag HG10393-CH
    PGD cDNA ORF Clone, Human, N-His tag HG10393-NH
    PGD cDNA ORF Clone, Human, C-HA tag HG10393-CY
    PGD cDNA ORF Clone, Human, N-HA tag HG10393-NY
    PGD cDNA ORF Clone, Human, C-Myc tag HG10393-CM
    PGD cDNA ORF Clone, Human, N-Myc tag HG10393-NM
    PGD qPCR Primer Pairs, Human HP100425
    info info
    添加购物车成功! 添加购物车失败!