PGD cDNA ORF Clone, Human, untagged

1/1

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

PGD cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1452 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human phosphogluconate dehydrogenase DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
HindIII + XhoI
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PGD cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PGD cDNA ORF Clone, Human, untagged: Validated Images

PGD cDNA ORF Clone, Human, untagged: Alternative Names

6PGD cDNA ORF Clone, Human

PGD Background Information

Full Name
phosphogluconate dehydrogenase
References
  • Baillet A, et al. (2011) Coupling of 6-phosphogluconate dehydrogenase with NADPH oxidase in neutrophils: Nox2 activity regulation by NADPH availability. FASEB J. 25(7): 2333-43.
  • Rho HK, et al. (2005) Transcriptional regulation of mouse 6-phosphogluconate dehydrogenase by ADD1/SREBP1c. Biochem Biophys Res Commun. 332(1): 288-96.
  • Broedel SE, et al. (1990). Genetic tagging, cloning, and DNA sequence of the Synechococcus sp. strain PCC 7942 gene (gnd) encoding 6-phosphogluconate dehydrogenase. J Bacteriol. 172 (7): 4023-31.
  • Adams MJ, et al. (1983). The three dimensional structure of sheep liver 6-phosphogluconate dehydrogenase at 2.6 A resolution. EMBO J. 2 (6): 1009-14.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait