Text Size:AAA

Human POU5F1 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
POU5F1cDNA Clone Product Information
Gene Bank Ref.ID:NM_002701.4
cDNA Size:1083
cDNA Description:ORF Clone of Homo sapiens POU class 5 homeobox 1 DNA.
Gene Synonym:OCT3, OCT4, OTF3, OTF4, OTF-3, Oct-3, Oct-4, MGC22487, POU5F1
Species:Human
Vector:pCMV/hygro-HA
Restriction Site:NheI + XbaI
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for 21 G/A, 27 C/T and 1047 C/T not causing the amino acid variation.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro-HA Vector Information
 
Vector Name pCMV/hygro-HA
Vector Size 5684bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
pCMV/hygro-HA Physical Map
Schematic of pCMV/hygro-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Catalog:HG13137-G-Y
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability5 business days
Images
  • Human POU5F1 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"