_×
Human POU5F1 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged
  0 products, total $0.+86-400-890-9989      Login |  Register 中文한국어

Browse By Molecule:

Your Position: Home > Gene Products > Expression-ready cDNA Clones > Human POU5F1 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged

Human POU5F1 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged

Catalog Vector (Price) Quantity In Stock Operation
HG13137-G-Y
  YES

*  pCMV vectors are ALL featured with a CMV promoter and a hygromycin-resistance (hygro) gene. These plasmids can be used directly in mammalian cell expression. Learn more about pCMV vectors.

Antibody Production Services

POU5F1 cDNA Clone Datasheet

 

POU5F1 cDNA Clone Product Information

Gene Bank Ref.ID:

NM_002701.4

cDNA Size:

1083

Gene Synonym:

OCT3; OCT4; OTF3; OTF4; OTF-3; Oct-3; Oct-4; MGC22487; POU5F1

Source: Human

POU5F1 cDNA Clone Description

cDNA Description:

ORF Clone of Homo sapiens POU class 5 homeobox 1 DNA.

Vector:

pCMV/hygro-HA

HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description: Identical with the Gene Bank Ref. ID sequence except for 21 G/A, 27 C/T and 1047 C/T not causing the amino acid variation.

POU5F1 cDNA Clone Shipping

  1. 5-10μg Plasmid DNA is shipped on Whatman FTA elute card (Cat. No.: WB120410) at room temperature.
  2. It would take 7-14 days for delivery typically. For bulk orders, additional 1-2 weeks would be needed.

POU5F1 cDNA Clone Usage Protocol

  1. Cut along the circle edge of the spot (arrow points to) to get the filter paper.
  2. Transfer the filter paper to a 1.5ml microfuge tube containing 150-200 μl of sterile H2O Ensure the filter is completely immersed in the H2O Briefly centrifuge the tube for 10 seconds.
  3. Incubate the tube at 95℃ for 15-30 min.
  4. At the end of the incubation pulse vortex, or gently tap the tube.
  5. Briefly centrifuge for 30 seconds, to separate the matrix from the elute. The elute now contains the purified DNA.

POU5F1 cDNA Clone Sequence and Quality Control

Sequence:

1        ATGGCGGGAC ACCTGGCTTC AGATTTTGCC TTCTCGCCCC CTCCAGGTGG TGGAGGTGAT
61       GGGCCAGGGG GGCCGGAGCC GGGCTGGGTT GATCCTCGGA CCTGGCTAAG CTTCCAAGGC
121      CCTCCTGGAG GGCCAGGAAT CGGGCCGGGG GTTGGGCCAG GCTCTGAGGT GTGGGGGATT
181      CCCCCATGCC CCCCGCCGTA TGAGTTCTGT GGGGGGATGG CGTACTGTGG GCCCCAGGTT
241      GGAGTGGGGC TAGTGCCCCA AGGCGGCTTG GAGACCTCTC AGCCTGAGGG CGAAGCAGGA
301      GTCGGGGTGG AGAGCAACTC CGATGGGGCC TCCCCGGAGC CCTGCACCGT CACCCCTGGT
361      GCCGTGAAGC TGGAGAAGGA GAAGCTGGAG CAAAACCCGG AGGAGTCCCA GGACATCAAA
421      GCTCTGCAGA AAGAACTCGA GCAATTTGCC AAGCTCCTGA AGCAGAAGAG GATCACCCTG
481      GGATATACAC AGGCCGATGT GGGGCTCACC CTGGGGGTTC TATTTGGGAA GGTATTCAGC
541      CAAACGACCA TCTGCCGCTT TGAGGCTCTG CAGCTTAGCT TCAAGAACAT GTGTAAGCTG
601      CGGCCCTTGC TGCAGAAGTG GGTGGAGGAA GCTGACAACA ATGAAAATCT TCAGGAGATA
661      TGCAAAGCAG AAACCCTCGT GCAGGCCCGA AAGAGAAAGC GAACCAGTAT CGAGAACCGA
721      GTGAGAGGCA ACCTGGAGAA TTTGTTCCTG CAGTGCCCGA AACCCACACT GCAGCAGATC
781      AGCCACATCG CCCAGCAGCT TGGGCTCGAG AAGGATGTGG TCCGAGTGTG GTTCTGTAAC
841      CGGCGCCAGA AGGGCAAGCG ATCAAGCAGC GACTATGCAC AACGAGAGGA TTTTGAGGCT
901      GCTGGGTCTC CTTTCTCAGG GGGACCAGTG TCCTTTCCTC TGGCCCCAGG GCCCCATTTT
961      GGTACCCCAG GCTATGGGAG CCCTCACTTC ACTGCACTGT ACTCCTCGGT CCCTTTCCCT
1021     GAGGGGGAAG CCTTTCCCCC TGTCTCTGTC ACCACTCTGG GCTCTCCCAT GCATTCAAAC
1081     GCT1TATCCTT ACGACGTGCC TGACTACGCC2 TAA

 

1. GCT was the nucleotide residue from the restriction site during plasmid construction,
which has no influence on protein expression.
2. HA Tag

 


 

Quality Control:cDNA sequencing results is available upon request.


 

 
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"