After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human Oct4 / POU5F1 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human POU5F1 cDNA Clone Product Information
NCBI RefSeq:NM_002701.4
RefSeq ORF Size:1083bp
cDNA Description:Full length Clone DNA of Homo sapiens POU class 5 homeobox 1 with HA tag.
Gene Synonym:OCT3, OCT4, OTF3, OTF4, OTF-3, Oct-3, Oct-4, MGC22487, POU5F1
Species:Human
Vector:pCMV/hygro-HA
Plasmid:pCMV-POU5F1-ha
Restriction Site:NheI + XbaI (5.5kb + 1.11kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for 21 G/A, 27 C/T and 1047 C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human POU5F1 Gene Plasmid Map
Human POU5F1 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged
pCMV2-HA Vector Information
 
Vector Name pCMV2-HA
Vector Size 5595bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV2-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Contact Us
Images
  • Human POU5F1 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"