Quick Order

Human PRL/Prolactin Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Human PRL cDNA Clone Product Information
    NCBI RefSeq:NM_000948.3
    RefSeq ORF Size:684bp
    cDNA Description:Full length Clone DNA of Homo sapiens prolactin.
    Gene Synonym:PRL
    Species:Human
    Vector:pCMV/hygro
    Plasmid:pCMV-PRL
    Restriction Site:KpnI + XhoI (5.5kb + 0.68kb)
    Tag Sequence:
    Sequence Description:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PRL qPCR primers for gene expression analysis, HP100322 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    pCMV/hygro Vector Information
     
    Vector Name pCMV/hygro
    Vector Size 5657bp
    Vector Type Mammalian Expression Vector
    Expression Method Constiutive ,Stable / Transient
    Promoter CMV
    Antibiotic Resistance Ampicillin
    Selection In Mammalian Cells Hygromycin
    Protein Tag None
    Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)


    Schematic of pCMV/hygro Multiple Cloning Sites
    Product nameProduct name
    References
  • Jara LJ, et al. (2011) Prolactin and autoimmunity. Clin Rev Allergy Immunol. 40(1): 50-9.
  • Urban A, et al. (2007) Prolactin as a factor for increased platelet aggregation. Neuro Endocrinol Lett. 28(4): 518-23.
  • Charoenphandhu N, et al. (2007) Prolactin is an important regulator of intestinal calcium transport. Can J Physiol Pharmacol. 85(6): 569-81.
  • Tworoger SS, et al. (2006) Prolactin and breast cancer risk. Cancer Lett. 243(2): 160-9.
  • Ben-Jonathan N, et al. (2006) Focus on prolactin as a metabolic hormone. Trends Endocrinol Metab. 17(3): 110-6.
  • Size / Price
    Catalog: HG10275-M-N
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"