Quick Order

Human PRL/Prolactin Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human PRL cDNA Clone Product Information
NCBI RefSeq:NM_000948.3
RefSeq ORF Size:684bp
cDNA Description:Full length Clone DNA of Homo sapiens prolactin.
Gene Synonym:PRL
Restriction Site:KpnI + XhoI (5.5kb + 0.68kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
  • Jara LJ, et al. (2011) Prolactin and autoimmunity. Clin Rev Allergy Immunol. 40(1): 50-9.
  • Urban A, et al. (2007) Prolactin as a factor for increased platelet aggregation. Neuro Endocrinol Lett. 28(4): 518-23.
  • Charoenphandhu N, et al. (2007) Prolactin is an important regulator of intestinal calcium transport. Can J Physiol Pharmacol. 85(6): 569-81.
  • Tworoger SS, et al. (2006) Prolactin and breast cancer risk. Cancer Lett. 243(2): 160-9.
  • Ben-Jonathan N, et al. (2006) Focus on prolactin as a metabolic hormone. Trends Endocrinol Metab. 17(3): 110-6.
  • Size / Price
    Catalog: HG10275-M-N
    List Price: 
    Price:      (You Save: )
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.