Text Size:AAA

Human PRKCB Gene cDNA Clone (full-length ORF Clone) expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PRKCBcDNA Clone Product Information
Gene_bank_ref_id:NM_002738.6
cDNA Size:2022
cDNA Description:ORF Clone of Homo sapiens protein kinase C, beta DNA.
Gene Synonym:PKCB, PRKCB1, PRKCB2, MGC41878, PKC-beta, PRKCB
Species:Human
Vector:pCMV/hygro
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human PRKCB Gene cDNA Clone (full-length ORF Clone) expression ready, untagged on other vectors
Human PRKCB Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10750-ACG$345
Human PRKCB Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10750-ACR$345
Human PRKCB Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10750-ANG$345
Human PRKCB Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10750-ANR$345
Human PRKCB Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10750-CF$315
Human PRKCB Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10750-CH$315
Human PRKCB Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10750-CM$315
Human PRKCB Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10750-CY$315
Human PRKCB Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10750-NF$315
Human PRKCB Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10750-NH$315
Human PRKCB Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10750-NM$315
Human PRKCB Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10750-NY$315
Human PRKCB Gene cDNA Clone (full-length ORF Clone)HG10750-U$115
Human PRKCB Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10750-U-F$445
Human PRKCB Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10750-U-N$445
Human PRKCB Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10750-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
Catalog:HG10750-U-N
List Price: $445.00  (Save $130.00)
Price:$315.00      [How to order]
Availability5 business days
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"