Prolyl Endopeptidase cDNA ORF Clone, Human, untagged

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

Prolyl Endopeptidase cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2133 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human prolyl endopeptidase DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Prolyl Endopeptidase cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Prolyl Endopeptidase cDNA ORF Clone, Human, untagged: Alternative Names

PE cDNA ORF Clone, Human; PEP cDNA ORF Clone, Human

Prolyl Endopeptidase Background Information

Prolyl endopeptidase, also known as PREP, belongs to a distinct class of serine peptidases. It is a large cytosolic enzyme which was first described in the cytosol of rabbit brain as an oligopeptidase. Prolyl endopeptidase degrades the nonapeptide bradykinin at the Pro-Phe bond. It is involved in the maturation and degradation of peptide hormones and neuropeptides such as alpha-melanocyte-stimulating hormone, luteinizing hormone-releasing hormone (LH-RH), thyrotropin-releasing hormone, angiotensin, neurotensin, oxytocin, substance P and vasopressin. Prolyl endopeptidase's activity is confined to action on oligopeptides of less than 1 kD and it has an absolute requirement for the trans-configuration of the peptide bond preceding proline. It cleaves peptide bonds at the C-terminal side of proline residues.
Full Name
prolyl endopeptidase
References
  • Oliveira EB, et al. (1976) Isolation of brain endopeptidases: Influence of size and sequence of substrates structurally related to bradykinin. Biochemistry. 15(9):1967-74.
  • Stepniak D, et al. (2006) Highly efficient gluten degradation with a newly identified prolyl endoprotease: implications for celiac disease. Am J Physiol Gastrointest Liver Physiol. 291(4): G621-9.
  • Jarho EM, et al. (2007) 2(S)-(Cycloalk-1-enecarbonyl)-1-(4-phenyl-butanoyl)pyrrolidines and 2(S)-(aroyl)-1-(4-phenylbutanoyl)pyrrolidines as prolyl oligopeptidase inhibitors. Bioorg Med Chem. 15(5):2024-31.
Add to Cart Successfully Add to Cart Failed