Quick Order

Human PRKCD Gene ORF cDNA clone expression plasmid, C-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Human PRKCD cDNA Clone Product Information
    NCBI RefSeq:NM_006254.3
    RefSeq ORF Size:2031bp
    cDNA Description:Full length Clone DNA of Homo sapiens protein kinase C, delta with Flag tag.
    Gene Synonym:MAY1, PKCD, MGC49908, nPKC-delta
    Restriction Site:KpnI + XhoI (5.4kb + 2.08kb)
    Sequence Description:Identical with the Gene Bank Ref. ID sequence except for three point mutations: 1441 C/T, 1782 C/G and 1857 T/C not causing the amino acid variation.
    ( We provide with PRKCD qPCR primers for gene expression analysis, HP100905 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    pCMV2-FLAG Vector Information
    Vector Name pCMV2-FLAG
    Vector Size 5592bp
    Vector Type Mammalian Expression Vector
    Expression Method Constiutive, Stable / Transient
    Promoter CMV
    Antibiotic Resistance Kanamycin
    Selection In Mammalian Cells Hygromycin
    Protein Tag FLAG
    Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

    Schematic of pCMV2-FLAG Multiple Cloning Sites

    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
  • Cross T, et al. (2000) PKC-delta is an apoptotic lamin kinase. Oncogene. 19(19): 2331-7.
  • Song JS, et al. (1998) Tyrosine phosphorylation-dependent and -independent associations of protein kinase C-delta with Src family kinases in the RBL-2H3 mast cell line: regulation of Src family kinase activity by protein kinase C-delta. Oncogene. 16(26): 3357-68.
  • Shanmugam M, et al. (1998) Association of PKC delta and active Src in PMA-treated MCF-7 human breast cancer cells. Oncogene. 16(13): 1649-54.
  • Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.