Text Size:AAA

Human PKC delta / PRKCD Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PRKCDcDNA Clone Product Information
Gene Bank Ref.ID:NM_006254.3
cDNA Size:2031
cDNA Description:ORF Clone of Homo sapiens protein kinase C, delta DNA.
Gene Synonym:MAY1, PKCD, MGC49908, nPKC-delta
Species:Human
Vector:pCMV2-FLAG
Restriction Site:KpnI + XhoI
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for three point mutations: 1441 C/T, 1782 C/G and 1857 T/C not causing the amino acid variation.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-FLAG Vector Information
 
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV2-FLAG Physical Map
Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
References
  • Cross T, et al. (2000) PKC-delta is an apoptotic lamin kinase. Oncogene. 19(19): 2331-7.
  • Song JS, et al. (1998) Tyrosine phosphorylation-dependent and -independent associations of protein kinase C-delta with Src family kinases in the RBL-2H3 mast cell line: regulation of Src family kinase activity by protein kinase C-delta. Oncogene. 16(26): 3357-68.
  • Shanmugam M, et al. (1998) Association of PKC delta and active Src in PMA-treated MCF-7 human breast cancer cells. Oncogene. 16(13): 1649-54.
  • Catalog:HG10769-M-F
    List Price: $345.00  (Save $30.00)
    Price:$315.00      [How to order]
    Availability5 business days
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"