Quick Order

Human PGF Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human PGF cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
  • Nagy JA, et al. (2003) VEGF-A(164/165) and PlGF: roles in angiogenesis and arteriogenesis. Trends Cardiovasc Med. 13(5): 169-75.
  • Chaballe L, et al. (2011) Placental growth factor: a tissue modelling factor with therapeutic potentials in neurology? Acta Neurol Belg. 111(1): 10-7.
  • Odorisio T, et al. (2006) The placenta growth factor in skin angiogenesis. J Dermatol Sci. 41(1): 11-9.
  • Contact Us
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.