Quick Order

Human PGF Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Human PGF cDNA Clone Product Information
    NCBI RefSeq:
    RefSeq ORF Size:
    cDNA Description:
    Gene Synonym:
    Species:Human
    Vector:
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PGF qPCR primers for gene expression analysis, HP100321 )
    Promoter:
    Application:
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:
    Shipping_carrier:
    Storage:
    pCMV/hygro Vector Information
     
    Vector Name pCMV/hygro
    Vector Size 5657bp
    Vector Type Mammalian Expression Vector
    Expression Method Constiutive ,Stable / Transient
    Promoter CMV
    Antibiotic Resistance Ampicillin
    Selection In Mammalian Cells Hygromycin
    Protein Tag None
    Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)


    Schematic of pCMV/hygro Multiple Cloning Sites
    Product nameProduct name
    References
  • Nagy JA, et al. (2003) VEGF-A(164/165) and PlGF: roles in angiogenesis and arteriogenesis. Trends Cardiovasc Med. 13(5): 169-75.
  • Chaballe L, et al. (2011) Placental growth factor: a tissue modelling factor with therapeutic potentials in neurology? Acta Neurol Belg. 111(1): 10-7.
  • Odorisio T, et al. (2006) The placenta growth factor in skin angiogenesis. J Dermatol Sci. 41(1): 11-9.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"