Quick Order

Human PFK2 / PFKFB3 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human PFK2/PFKFB3 cDNA Clone Product Information
NCBI RefSeq:BC040482
RefSeq ORF Size:1563bp
cDNA Description:Full length Clone DNA of Homo sapiens 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 with Flag tag.
Gene Synonym:PFK2, IPFK2
Restriction Site:KpnI + XhoI (5.5kb + 1.59kb)
Sequence Description:Identical with the Gene Bank Ref.ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PFK2/PFKFB3 Gene Plasmid Map
Human PFKFB3 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Fructose-2,6-biphosphatase 3, also known as 6-phosphofructo-2-kinase or PFK2 or PFKFB3, is a potent activator of phosphofructokinase, which is a rate-limiting enzyme of glycolysis. Highly phosphorylated PFKFB3 protein was found in human tumor cells, vascular endothelial cells, and smooth muscle cells. Fructose 2,6-bisphosphate (Fru-2,6-BP) is an allosteric activator of 6-phosphofructo-1-kinase (PFK-1), a rate-limiting enzyme and essential control point in glycolysis. The concentration of PFK2 depends on the activity of the bifunctional enzyme, 6-phosphofructo-2-kinase / fructose-2,6-bisphosphatase (PFK-2 / FBPase). PFK2 controls the glycolytic flux via the allosteric activator fructose 2,6-bisphosphate. Because of its proto-oncogenic character, the PFK-2/FBPase-2 of the PFKFB3 gene is assumed to play a critical role in tumorigenesis. The hypoxia-inducible form of 6-phosphofructo-2-kinase / fructose-2,6-bisphosphatase (PFKFB3) plays a crucial role in the progression of cancerous cells by enabling their glycolytic pathways even under severe hypoxic conditions.

  • Kessler R, et al. (2008) 6-Phosphofructo-2-kinase/fructose-2,6-bisphosphatase (PFKFB3) is up-regulated in high-grade astrocytomas. J Neurooncol. 86(3):257-64.
  • Yalcin A, et al. (2009) Nuclear targeting of 6-phosphofructo-2-kinase (PFKFB3) increases proliferation via cyclin-dependent kinases. J Biol Chem. 284(36):24223-32.
  • Atsumi T, et al. (2002) High expression of inducible 6-phosphofructo-2-kinase / fructose-2, 6-bisphosphatase (iPFK-2; PFKFB3) in human cancers. Cancer Res. 262(20): 5881-7.
  • Kim SG, et al. (2006) Crystal structure of the hypoxia-inducible form of 6-phosphofructo-2-kinase / fructose-2,6-bisphosphatase (PFKFB3): a possible new target for cancer therapy. J Biol Chem. 281(5): 2939-44.
  • Contact Us
    • Human PFKFB3 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.