Quick Order

Human PDGF-C Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Human PDGFC cDNA Clone Product Information
    NCBI RefSeq:NM_016205.1
    RefSeq ORF Size:1038bp
    cDNA Description:Full length Clone DNA of Homo sapiens platelet derived growth factor C.
    Restriction Site:KpnI + XhoI (5.5kb + 1.04kb)
    Tag Sequence:
    Sequence Description:Identical with the Gene Bank Ref. ID sequence.
    ( We provide with PDGFC qPCR primers for gene expression analysis, HP100320 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    pCMV/hygro Vector Information
    Vector Name pCMV/hygro
    Vector Size 5657bp
    Vector Type Mammalian Expression Vector
    Expression Method Constiutive ,Stable / Transient
    Promoter CMV
    Antibiotic Resistance Ampicillin
    Selection In Mammalian Cells Hygromycin
    Protein Tag None
    Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

    Schematic of pCMV/hygro Multiple Cloning Sites
    Product nameProduct name

    PDGF-C is a member of the PDGF/VEGF family of growth factors with a unique domain organization and expression pattern. Platelet-derived growth factor receptors (PDGFRs) are catalytic receptors that have intracellular tyrosine kinase activity. They have roles in the regulation of many biological processes including embryonic development, angiogenesis, cell proliferation and differentiation, and contribute to the pathophysiology of some diseases, including cancer. There are two isoforms of the PDGFR receptor; PDGFRalpha and PDGFRbeta, which can form homo- or heterodimers. The endogenous PDGFR ligands are PDGF-A, -B, -C and -D, which induce receptor dimerization and transphosphorylation at specific tyrosine residues upon binding. This activates the intracellular kinase activity, initiating intracellular signaling through the MAPK, PI 3-K and PKCgamma pathways. PDGF-C acts as a specific ligand for alpha platelet-derived growth factor receptor homodimer, and alpha and beta heterodimer. Binding of this growth factor to its affinity receptor elicits a variety of cellular responses. PDGF-C Appears to be involved in the three stages of wound healing: inflammation, proliferation and remodeling. Involved in fibrotic processes, in which transformation of interstitial fibroblasts into myofibroblasts plus collagen deposition occurs.

  • Li X, et al. (2000) PDGF-C is a new protease-activated ligand for the PDGF alpha-receptor. Nat Cell Biol. 2 (5): 302-9.
  • Ding H, et al. (2004) A specific requirement for PDGF-C in palate formation and PDGFR-alpha signaling. Nat Genet. 36 (10): 1111-6.
  • Choi SJ, et al. (2009) The PDGF-C regulatory region SNP rs28999109 decreases promoter transcriptional activity and is associated with CL/P. European Journal of Human Genetics. 17 (11): 774-84.
  • Size / Price
    Catalog: HG10273-M-N
    List Price: 
    Price:      (You Save: )
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.