Quick Order

Human PD-L2/B7-DC/CD273 Gene ORF cDNA clone expression plasmid

  • Human PDCD1LG2 / PD-L2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human PD-L2 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:Human
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:( We provide with PDCD1LG2 qPCR primers for gene expression analysis, HP100337 )
Shipping_carrier:
Storage:
Human PD-L2 Gene Plasmid Map
Human PDCD1LG2 / PD-L2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Programmed death ligand 2 (PD-L2), also referred to as B7-DC and CD273, is a member of the B7 family of proteins including B7-1, B7-2, B7-H2, B7-H1 (PD-L1), and B7-H3. PD-L2 is a type I membrane protein and structurally consists of an extracellular region containing one V-like and one C-like Ig domain, a transmembrane region, and a short cytoplasmic domain. PD-L2 is expressed on antigen presenting cells, placental endothelium and medullary thymic epithelial cells, and can be induced by LPS in B cells, INF-γ in monocytes, or LPS plus IFN-γ in dendritic cells. The CD28 and B7 protein families are critical regulators of immune responses. PD-L2 and PD-L1 are two ligands for PD-1, member of the CD28/CTLA4 family expressed on activated lymphoid cells, and thus provide signals for regulating T cell activation and immune tolerance. The interaction of B7-DC/PD-1 exhibited a 2-6-fold higher affinity compared with the interaction of B7-H1/PD-1.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

References
  • Latchman Y, et al. (2001) PD-L2 is a second ligand for PD-1 and inhibits T cell activation. Nat Immunol. 2: 261-8.
  • Carreno BM, et al. (2005) Therapeutic opportunities in the B7/CD28 family of ligands and receptors. Curr Opin Pharmacol. 5(4): 424-30.
  • Radhakrishnan S, et al. (2007) B7-DC/PD-L2 cross-linking induces NF-kappaB-dependent protection of dendritic cells from cell death. J Immunol. 178(3): 1426-32.
  • Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"