Quick Order

Text Size:AAA

Human PCSK1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human PCSK1 cDNA Clone Product Information
NCBI RefSeq:NM_000439.4
RefSeq ORF Size:2262bp
cDNA Description:Full length Clone DNA of Homo sapiens proprotein convertase subtilisin/kexin type 1.
Gene Synonym:PC1, PC3, NEC1, SPC3, BMIQ12, PCSK1
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-PCSK1
Restriction Site:KpnI + XhoI (5.5kb + 2.26kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PCSK1 Gene Plasmid Map
Human PCSK1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Neuroendocrine convertase 1, also known as Prohormone convertase 1, Proprotein convertase 1, PCSK1 and NEC1, is an enzyme which belongs to the peptidase S8 family and Furin subfamily. PCSK1 is an enzyme that performs the proteolytic cleavage of prohormones to their intermediate (or sometimes completely cleaved) forms. It is present only in neuroendocrine cells such as brain, pituitary and adrenal, and most often cleaves after a pair of basic residues within prohormones but can occasionally cleave after a single arginine. It binds to a protein known as proSAAS, which also represents its endogenous inhibitor. PCSK1 is involved in the processing of hormone and other protein precursors at sites comprised of pairs of basic amino acid residues. PCSK1 substrates include POMC, renin, enkephalin, dynorphin, somatostatin and insulin. Defects in PCSK1 are the cause of proprotein convertase 1 deficiency (PC1 deficiency). PC1 deficiency is characterized by obesity, hypogonadism, hypoadrenalism, reactive hypoglycemia as well as marked small-intestinal absorptive dysfunction. It is due to impaired processing of prohormones.

References
  • Jackson RS. et al., 2003, J. Clin. Invest. 112:1550-60.
  • Farooqi I.S. et al., 2007, J. Clin. Endocrinol. Metab. 92: 3369-73.
  • Benzinou,M. et al., 2008,Nat Genet. 40 (8):943-5.
  • Benzinou M. et al., 2008, Nat. Genet. 40:943-5.
  • Renström F, et al., 2009, Hum. Mol. Genet. 18 (8): 1489-96.
  • Size / Price
    Catalog: HG10129-M-N
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human PCSK1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"