Quick Order

Human OMGP Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Human OMG cDNA Clone Product Information
    NCBI RefSeq:
    RefSeq ORF Size:
    cDNA Description:
    Gene Synonym:
    Species:Human
    Vector:
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with OMG qPCR primers for gene expression analysis, HP100317 )
    Promoter:
    Application:
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:
    Shipping_carrier:
    Storage:
    pCMV/hygro Vector Information
     
    Vector Name pCMV/hygro
    Vector Size 5657bp
    Vector Type Mammalian Expression Vector
    Expression Method Constiutive ,Stable / Transient
    Promoter CMV
    Antibiotic Resistance Ampicillin
    Selection In Mammalian Cells Hygromycin
    Protein Tag None
    Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)


    Schematic of pCMV/hygro Multiple Cloning Sites
    Product nameProduct name
    Background

    Oligodendrocyte-myelin glycoprotein, also known as OMG and OMGP, is a cell membrane protein which contains eight LRR (leucine-rich) repeats. OMG / OMGP is a glycosylphosphatidylinositol-anchored protein expressed by neurons and oligodendrocytes in the central nervous system (CNS). OMG / OMGP is a cell adhesion molecule contributing to the interactive process required for myelination in the central nervous system. OMG / OMGP play roles in both the developing and adult central nervous system. OMG / OMGP participats in growth cone collapse and inhibition of neurite outgrowth through its interaction with NgR, the receptor for Nogo. This function requires its leucine-rich repeat domain, a highly conserved region in OMgp during mammal evolution. OMG / OMGP leucine-rich repeat domain is also implicated in the inhibition of cell proliferation. OMG / OMGP may also be involved in the formation and maintenance of myelin sheaths. Cell proliferation, neuronal sprouting and myelination are crucial processes involved in brain development and regeneration after injury.

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"