Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-His tag

Cat: VG40329-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All NiV Nucleocapsid Reagents
CRO Services
Product recommended

All NiV Nucleocapsid Reagents
Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-His tag General Information
Gene
Species
NiV
NCBI Ref Seq
RefSeq ORF Size
1599 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Nipah virus (NiV) (strain Malaysian (NiV-M)) N with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NiV Nucleocapsid Background Information

NiV Nucleocapsid cDNA ORF Clone, NiV, Related Products

Product Name Catalog#(PDF)
Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid VG40329-G
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid VG40331-G
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N natural ORF mammalian expression plasmid VG40331-UT
Nipah virus (NiV) (strain Malaysian (NiV-M)) N natural ORF mammalian expression plasmid VG40329-UT
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40331-ACGLN
Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, C-GFPSpark tag VG40329-ACG
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid, C-GFPSpark tag VG40331-ACG
Nipah virus (NiV) (strain Malaysian (NiV-M)) N Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40329-ACGLN
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid, N-GFPSpark tag VG40331-ANG
Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-GFPSpark tag VG40329-ANG
Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40329-ACR
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40331-ACR
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40331-ANR
Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40329-ANR
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged VG40331-CF
Nipah virus (NiV) (strain Malaysian (NiV-M)) N Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged VG40329-CF
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid, N-Flag tag VG40331-NF
Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-Flag tag VG40329-NF
Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, C-His tag VG40329-CH
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid, C-His tag VG40331-CH
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid, N-His tag VG40331-NH
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid, C-HA tag VG40331-CY
Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, C-HA tag VG40329-CY
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid, N-HA tag VG40331-NY
Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-HA tag VG40329-NY
Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, C-Myc tag VG40329-CM
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid, C-Myc tag VG40331-CM
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid, N-Myc tag VG40331-NM
Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-Myc tag VG40329-NM
info info
添加购物车成功! 添加购物车失败!