Quick Order

Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    NiV NiV-N cDNA Clone Product Information
    NCBI RefSeq:AY029767.1
    RefSeq ORF Size:1599bp
    cDNA Description:Full length Clone DNA of Nipah virus (NiV) (strain Malaysian (NiV-M)) N with N terminal His tag.
    Gene Synonym:NiV-N
    Species:NiV
    Vector:pCMV3-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-His tag on other vectors
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, C-GFPSpark tagVG40329-ACG$345
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40329-ACR$345
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-GFPSpark tagVG40329-ANG$345
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40329-ANR$345
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40329-CF$315
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, C-His tagVG40329-CH$315
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, C-Myc tagVG40329-CM$315
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, C-HA tagVG40329-CY$315
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmidVG40329-G$115
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-Flag tagVG40329-NF$315
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-His tagVG40329-NH$315
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-Myc tagVG40329-NM$315
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-HA tagVG40329-NY$315
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N natural ORF mammalian expression plasmidVG40329-UT$315
     Learn more about expression Vectors
    Product nameProduct name
    Size / Price
    Catalog: VG40329-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"