Text Size:AAA

Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    NiV NiV-N cDNA Clone Product Information
    NCBI RefSeq:AY029767.1
    RefSeq ORF Size:1599bp
    cDNA Description:Full length Clone DNA of Nipah virus (NiV) (strain Malaysian (NiV-M)) N with N terminal His tag.
    Gene Synonym:NiV-N
    Restriction Site:
    Sequence Description:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7( 5' TAATACGACTCACTATAGGG 3' )
    Promoter:Enhanced CMV cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-His tag on other vectors
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, C-GFPSpark tagVG40329-ACG$345
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40329-ACR$345
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-GFPSpark tagVG40329-ANG$345
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40329-ANR$345
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40329-CF$315
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, C-His tagVG40329-CH$315
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, C-Myc tagVG40329-CM$315
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, C-HA tagVG40329-CY$315
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmidVG40329-G$115
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-Flag tagVG40329-NF$315
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-His tagVG40329-NH$315
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-Myc tagVG40329-NM$315
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-HA tagVG40329-NY$315
    Nipah virus (NiV) (strain Malaysian (NiV-M)) N natural ORF mammalian expression plasmidVG40329-UT$315
     Learn more about expression Vectors
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.