Quick Order

Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Human Neuropilin-1 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human Neuropilin-1 Gene Plasmid Map
Human Neuropilin-1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Neuropilin is a type I transmembrane protein and the molecular mass is 120 kDa. Two homologues, Neuropilin-1 and Neuropilin-2, are identified. The primary structure of Neuropilin-1 and Neuropilin-2 is well conserved and is divided into four domains, CUB (a1/a2) domain, FV/FVIII (b1/b2) domain, MAM (c) domain, and (d) domain that contains a transmembrane and a short cytoplasmic region. Neuropilin-1 (NRP1) acts as a receptor for two different extracellular ligands, class 3 semaphorins and specific isoforms of vascular endothelial growth factor. The functions of NRP1 and NRP2 have been extensively studied in neurons where they act in axon guidance and in endothelial cells where they promote angiogenesis and cell migration. Neuropilin-1 is likely to mediate contacts between the dendritic cells and the T lymphocytes via homotypic interactions and is essential for the initiation of the primary immune response. NRP1 is a co-receptor for VEGF receptor-2 (VEGFR2) that enhances the binding of VEGF165 to VEGFR2 and VEGF165-mediated chemotaxis. NRP1 expression is regulated in EC by tumor necrosis factor-alpha, the transcription factors dHAND and Ets-1, and vascular injury. NRP1 upregulation is positively correlated with the progression of various tumors. Overexpression of NRPI in rat tumor cells results in enlarged tumors and substantially enhanced tumor angiogenesis. On the other hand, soluble NRP1 (sNRP1) is an antagonist of tumor angiogenesis.

  • Nakamura F, et al. (2002) Structural and functional relation of neuropilins. Adv Exp Med Biol. 515: 55-69.
  • Romeo PH, et al. (2002) Neuropilin-1 in the immune system. Adv Exp Med Biol. 515: 49-54.
  • Klagsbrun M, et al. (2002) The role of neuropilin in vascular and tumor biology. Adv Exp Med Biol. 515: 33-48.
  • Staton CA, et al. (2007) Neuropilins in physiological and pathological angiogenesis. J Pathol. 212(3): 237-48.
  • Bagri A, et al. (2009) Neuropilins in tumor biology. Clin Cancer Res. 15(6): 1860-4.
  • Contact Us
    • Human Neuropilin-1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.