Text Size:AAA

Human NGFR Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NGFRcDNA Clone Product Information
Gene Bank Ref.ID:NM_002507.2
cDNA Size:1284
cDNA Description:ORF Clone of Homo sapiens nerve growth factor receptor (TNFR superfamily, member 16) DNA.
Gene Synonym:CD271, p75NTR, TNFRSF16, p75(NTR), Gp80-LNGFR, NGFR
Species:Human
Vector:pCMV/hygro
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 6 G/A not causing the amino acid variation.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV/hygro Physical Map

Schematic of pCMV/hygro Multiple Cloning Sites
Human NGFR Gene cDNA Clone (full-length ORF Clone) on other vectors
Neurotrophin & Receptor Related Products
Background

Nerve growth factor receptors (NGFRs) belong to a large growth factor receptor family. NGFR includes two types of receptors: high-affinity nerve growth factor receptor and low-affinity nerve growth factor receptor. High-affinity nerve growth factor receptor is also referred as Trk familywhose members are bound by some neurotrophins with high affinity. Nerve growth factor binds with TrkA after being released from target cells, the NGF / TrkA complex is subsequently trafficked back to the cell body. The Low-affinity nerve growth factor receptor also named p75 which binds with all kinds of neurotrophins with low affinity. All the four kinds of neurotrophins, including Nerve growth factor, Brain derived neurotrophic factor, Neurotrophin-3, and Neurotrophin-4 bind to the p75. Studies have proved that NGFR acts as a molecular signal swith that determines cell death or survival by three steps. First, pro-nerve growth factor (prNGF) triggers cell apoptosis by its high affinity binding to p75NTR, while NGF induces neuronal survival with low-affinity binding. Second, p75NTR mediates cell death by combining with co-receptor sortilin, whereas it promotes neuronal survival through combination with proNGF. Third, release of the intracellular domain chopper or cleavage short p75 NTR can independently initiate neuronal apoptosis.

References
  • Chen LW, et al. (2008) The proNGF-p75NTR-sortilin signalling complex as new target for the therapeutic treatment of Parkinson's disease. CNS Neurol Disord Drug Targets. 7(6): 512-23.
  • Deponti D, et al. (2009) The low-affinity receptor for neurotrophins p75NTR plays a key role for satellite cell function in muscle repair acting via RhoA. Mol Biol Cell.20(16): 3620-7.
  • Ken-ichiro K, et al. (2004) Necdin-related MAGE proteins differentially interact with the E2F1 transcription factor and the p75 neurotrophin receptor. J Biol Chem. 279 (3): 1703-12.
  • Catalog:HG13184-G-N
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
    • Human NGFR Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"