NGF cDNA ORF Clone, Rat, C-His tag

Cat: RG80426-G-H

This product is not available, please contact order@sinobiological.com for relevant product if required.

Contact us:
215-583-7898
order@sinobiological.com
Distributors
All NGF Reagents
CRO Services

All NGF Reagents
NGF cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
726 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat nerve growth factor (beta polypeptide) with His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-His
Restriction Sites
KpnI + XhoI (5.5kb + 0.76kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
NGF cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NGF cDNA ORF Clone, Rat, C-His tag Validated Images
Rat NGF/NGFB/beta-NGF Gene Plasmid Map 7650
NGF Background Information

Nerve growth factor (NGF) is important for the development and maintenance of the sympathetic and sensory nervous systems. NGF protein was identified as a large complex consisting of three non-covalently linked subunits, α, β, and γ, among which, the β subunit, called β-NGF (beta-NGF), was demonstrated to exhibits the growth stimulating activity of NGF protein. NGFB/beta-NGF gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is incorporated into a larger complex. NGF protein acts via at least two receptors on the surface of cells (TrkA and p75 receptors) to regulate neuronal survival, promote neurite outgrowth, and up-regulate certain neuronal functions such as mediation of pain and inflammation. In addition, previous studies indicated that NGF may also have an important role in the regulation of the immune system.

Full Name
nerve growth factor (beta polypeptide)
References
  • Castellanos MR, et al. (2003) Evaluation of the neurorestorative effects of the murine beta-nerve growth factor infusions in old rat with cognitive deficit. Biochem Biophys Res Commun. 312(4): 867-72.
  • Wang TH, et al. (2008) Effects of pcDNA3-beta-NGF gene-modified BMSC on the rat model of Parkinson's disease. J Mol Neurosci. 35(2): 161-9.
  • Perrard MH, et al. (2009) Redundancy of the effect of TGFbeta1 and beta-NGF on the second meiotic division of rat spermatocytes. Microsc Res Tech. 72(8): 596-602.
  • NGF cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    NGF cDNA ORF Clone in Cloning Vector, Canine DG70027-G
    NGF cDNA ORF Clone, Canine, untagged DG70027-UT
    NGF cDNA ORF Clone, Canine, C-GFPSpark® tag DG70027-ACG
    NGF Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70027-ACGLN
    NGF cDNA ORF Clone, Canine, C-OFPSpark® tag DG70027-ACR
    NGF cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70027-CF
    NGF cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70027-NF
    NGF cDNA ORF Clone, Canine, C-His tag DG70027-CH
    NGF cDNA ORF Clone, Canine, N-His tag DG70027-NH
    NGF cDNA ORF Clone, Canine, C-HA tag DG70027-CY
    NGF cDNA ORF Clone, Canine, N-HA tag DG70027-NY
    NGF cDNA ORF Clone, Canine, C-Myc tag DG70027-CM
    NGF cDNA ORF Clone, Canine, N-Myc tag DG70027-NM

    NGF cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    NGF cDNA ORF Clone in Cloning Vector, Rat RG80426-G
    NGF cDNA ORF Clone, Rat, untagged RG80426-UT
    NGF Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80426-ACGLN
    NGF cDNA ORF Clone, Rat, C-GFPSpark® tag RG80426-ACG
    NGF cDNA ORF Clone, Rat, C-OFPSpark® tag RG80426-ACR
    NGF cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80426-CF
    NGF cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80426-NF
    NGF cDNA ORF Clone, Rat, C-His tag RG80426-CH
    NGF cDNA ORF Clone, Rat, N-His tag RG80426-NH
    NGF cDNA ORF Clone, Rat, C-HA tag RG80426-CY
    NGF cDNA ORF Clone, Rat, N-HA tag RG80426-NY
    NGF cDNA ORF Clone, Rat, C-Myc tag RG80426-CM
    NGF cDNA ORF Clone, Rat, N-Myc tag RG80426-NM
    NGF qPCR Primer Pairs, Rat RP300398

    NGF cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    NGF cDNA ORF Clone in Cloning Vector, Mouse MG50385-M
    NGF cDNA ORF Clone, Mouse, untagged MG50385-UT
    NGF cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50385-ACG
    NGF Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50385-ACGLN
    NGF cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50385-ACR
    NGF cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50385-CF
    NGF cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50385-NF
    NGF cDNA ORF Clone, Mouse, C-His tag MG50385-CH
    NGF cDNA ORF Clone, Mouse, N-His tag MG50385-NH
    NGF cDNA ORF Clone, Mouse, C-HA tag MG50385-CY
    NGF cDNA ORF Clone, Mouse, N-HA tag MG50385-NY
    NGF cDNA ORF Clone, Mouse, C-Myc tag MG50385-CM
    NGF cDNA ORF Clone, Mouse, N-Myc tag MG50385-NM
    NGF qPCR Primer Pairs, Mouse MP200404

    NGF cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    NGF cDNA ORF Clone, Human, untagged HG11050-UT
    NGF cDNA ORF Clone, Human, untagged HG11050-C
    NGF Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11050-ACGLN
    NGF cDNA ORF Clone, Human, C-GFPSpark® tag HG11050-ACG
    NGF cDNA ORF Clone, Human, C-OFPSpark® tag HG11050-ACR
    NGF cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11050-CF
    NGF cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11050-NF
    NGF cDNA ORF Clone, Human, C-His tag HG11050-CH
    NGF cDNA ORF Clone, Human, N-His tag HG11050-NH
    NGF cDNA ORF Clone, Human, C-HA tag HG11050-CY
    NGF cDNA ORF Clone, Human, N-HA tag HG11050-NY
    NGF cDNA ORF Clone, Human, C-Myc tag HG11050-CM
    NGF cDNA ORF Clone, Human, N-Myc tag HG11050-NM
    NGF qPCR Primer Pairs, Human HP101278
    info info
    添加购物车成功! 添加购物车失败!