NDP/EVR2 cDNA ORF Clone, Human, untagged

Cat: HG10263-M-N
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NDP/EVR2 Reagents
CRO Services

All NDP/EVR2 Reagents
NDP/EVR2 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
402 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human Norrie disease (pseudoglioma) DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
NDP/EVR2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NDP/EVR2 cDNA ORF Clone, Human, untagged Alternative Names
EVR2 cDNA ORF Clone, Human;FEVR cDNA ORF Clone, Human;ND cDNA ORF Clone, Human
NDP/EVR2 Background Information
Full Name
Norrie disease (pseudoglioma)

NDP/EVR2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NDP/EVR2 cDNA ORF Clone in Cloning Vector, Mouse MG50105-M
NDP/EVR2 cDNA ORF Clone, Mouse, untagged MG50105-UT
NDP/EVR2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50105-ACG
NDP/EVR2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50105-ACGLN
NDP/EVR2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50105-ACR
NDP/EVR2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50105-CF
NDP/EVR2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50105-NF
NDP/EVR2 cDNA ORF Clone, Mouse, C-His tag MG50105-CH
NDP/EVR2 cDNA ORF Clone, Mouse, N-His tag MG50105-NH
NDP/EVR2 cDNA ORF Clone, Mouse, C-HA tag MG50105-CY
NDP/EVR2 cDNA ORF Clone, Mouse, N-HA tag MG50105-NY
NDP/EVR2 cDNA ORF Clone, Mouse, C-Myc tag MG50105-CM
NDP/EVR2 cDNA ORF Clone, Mouse, N-Myc tag MG50105-NM
NDP/EVR2 qPCR Primer Pairs, Mouse MP200135

NDP/EVR2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NDP/EVR2 cDNA ORF Clone in Cloning Vector, Human HG10263-M
NDP/EVR2 cDNA ORF Clone, Human, untagged HG10263-UT
NDP/EVR2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10263-ACGLN
NDP/EVR2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10263-ACG
NDP/EVR2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10263-ACR
NDP/EVR2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10263-CF
NDP/EVR2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10263-NF
NDP/EVR2 cDNA ORF Clone, Human, C-His tag HG10263-CH
NDP/EVR2 cDNA ORF Clone, Human, N-His tag HG10263-NH
NDP/EVR2 cDNA ORF Clone, Human, C-HA tag HG10263-CY
NDP/EVR2 cDNA ORF Clone, Human, N-HA tag HG10263-NY
NDP/EVR2 cDNA ORF Clone, Human, C-Myc tag HG10263-CM
NDP/EVR2 cDNA ORF Clone, Human, N-Myc tag HG10263-NM
NDP/EVR2 qPCR Primer Pairs, Human HP100311
info info
添加购物车成功! 添加购物车失败!