Quick Order

Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Human NCSTN cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human NCSTN Gene Plasmid Map
Human NCSTN Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Nicastrin (NCST, or NCT), a single-pass membrane glycoprotein that harbors a large extracellular domain, is an essential component of the gamma-secretase complex. Several lines of evidence indicate that the members of these complexes could also contribute to the control of cell death. NCT controls cell death via phosphoinositide 3-kinase/Akt and p53-dependent pathways and that this function remains independent of the activity and molecular integrity of the gamma-secretase complexes. Increasing evidences have shown that Nicastrin/NCSTN plays a crucial role in gamma-cleavage of the amyloid precursor protein (APP). The glycoprotein Nicastrin is an essential component of the gamma-secretase complex, a high molecular weight complex which also contains the presenilin proteins, Aph-1 and Pen-2. The gamma-secretase complex is not only involved in APP processing but also in the processing of an increasing number of other type I integral membrane proteins. As the largest subunit of the gamma-secretase complex, Nicastrin plays a crucial role in its activation. Inhibition of NCSTN demonstrated an altered gamma-cleavage activity, suggesting its potential implication in developing Alzheimer's disease (AD). In addition, Nicastrin can function to maintain epithelial to mesenchymal transition during breast cancer progression. Anti-nicastrin polyclonal and monoclonal antibodies were able to decrease notch1 and vimentin expression and reduced the invasive capacity of breast cancer cells in vitro.

  • He G, et al. (2007) Degradation of nicastrin involves both proteasome and lysosome. J Neurochem. 101(4): 982-92.
  • Hayashi I, et al. (2009) Single chain variable fragment against nicastrin inhibits the gamma-secretase activity. J Biol Chem. 284(41): 27838-47.
  • Ma Z, et al. (2009) Association between promoter polymorphisms of the nicastrin gene and sporadic Alzheimer's disease in North Chinese Han population. Neurosci Lett. 458(3): 136-9.
  • Pardossi-Piquard R, et al. (2009) p53-dependent control of cell death by nicastrin: lack of requirement for presenilin-dependent gamma-secretase complex. J Neurochem. 109(1): 225-37.
  • Filipovi? A, et al. (2011) Biological and clinical implications of nicastrin expression in invasive breast cancer. Breast Cancer Res Treat. 125(1): 43-53.
  • Contact Us
    • Human NCSTN Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.