SFRP4 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50053-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SFRP4 Reagents
CRO Services
Product recommended

All SFRP4 Reagents
SFRP4 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1056 bp
Description
Full length Clone DNA of Mouse secreted frizzled-related protein 4 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SFRP4 Background Information

SFRP family consists of five secreted glycoproteins in humans acting as extracellular signaling ligands. Each is approximately 300 amino acids in length and contains a cysteine-rich domain (CRD) that shares 30-50% sequence homology with the CRD of Frizzled (Fz) receptors, a putative signal sequence, and a conserved hydrophilic carboxy-terminal domain. SFRPs act as soluble modulators of Wnt signaling, counteracting Wnt-induced effects at high concentrations and promoting them at lower concentrations. SFRPs are able to bind Wnt proteins and Fz receptors in the extracellular compartment. The interaction between SFRPs and Wnt proteins prevents the latter from binding the Fz receptors. The Wnt pathway plays a key role in embryonic development, cell differentiation and cell proliferation. SFRP4 is a member of the SFRP family that contains a cysteine-rich domain homologous to the putative Wnt-binding site of Frizzled proteins called FZ domain and a NTR domain . Mouse SFRP4 is highly expressed in the ovary, and is localized to granulosa cells of periovulatory follicles and corpora lutea. It plays a critical role in placental development and implantation, and is also an important factor in the development of the decidual fibrinoid zone, and in trophoblast apoptosis.

Full Name
secreted frizzled-related protein 4
References
  • Abu-Jawdeh G.M., et al.,(1999), Differential expression of frpHE: a novel human stromal protein of the secreted frizzled gene family, during the endometrial cycle and malignancy. Lab. Invest. 79:439-447.
  • Berndt T., et al., (2003), Secreted frizzled-related protein 4 is a potent tumor-derived phosphaturic agent.J. Clin. Invest. 112:785-794.
  • Ota T., et al.,(2004), Complete sequencing and characterization of 21,243 full-length human cDNAs.Nat. Genet. 36:40-45.
  • SFRP4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SFRP4 cDNA ORF Clone in Cloning Vector, Mouse MG50053-M
    SFRP4 cDNA ORF Clone, Mouse, untagged MG50053-UT
    SFRP4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50053-ACGLN
    SFRP4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50053-ACG
    SFRP4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50053-ACR
    SFRP4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50053-CF
    SFRP4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50053-NF
    SFRP4 cDNA ORF Clone, Mouse, C-His tag MG50053-CH
    SFRP4 cDNA ORF Clone, Mouse, N-His tag MG50053-NH
    SFRP4 cDNA ORF Clone, Mouse, N-HA tag MG50053-NY
    SFRP4 cDNA ORF Clone, Mouse, C-Myc tag MG50053-CM
    SFRP4 cDNA ORF Clone, Mouse, N-Myc tag MG50053-NM
    SFRP4 qPCR Primer Pairs, Mouse MP200053

    SFRP4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SFRP4 cDNA ORF Clone in Cloning Vector, Human HG10717-U
    SFRP4 cDNA ORF Clone, Human, untagged HG10717-UT
    SFRP4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10717-ACGLN
    SFRP4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10717-ACG
    SFRP4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10717-ACR
    SFRP4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10717-CF
    SFRP4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10717-NF
    SFRP4 cDNA ORF Clone, Human, C-His tag HG10717-U-H
    SFRP4 cDNA ORF Clone, Human, C-His tag HG10717-CH
    SFRP4 cDNA ORF Clone, Human, N-His tag HG10717-NH
    SFRP4 cDNA ORF Clone, Human, C-HA tag HG10717-CY
    SFRP4 cDNA ORF Clone, Human, N-HA tag HG10717-NY
    SFRP4 cDNA ORF Clone, Human, C-Myc tag HG10717-CM
    SFRP4 cDNA ORF Clone, Human, N-Myc tag HG10717-NM
    SFRP4 qPCR Primer Pairs, Human HP100658
    info info
    添加购物车成功! 添加购物车失败!