Quick Order

Mouse SFRP1 Gene ORF cDNA clone expression plasmid, N-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse SFRP1 cDNA Clone Product Information
    NCBI RefSeq:NM_013834.2
    RefSeq ORF Size:945bp
    cDNA Description:Full length Clone DNA of Mus musculus secreted frizzled-related protein 1 with C terminal HA tag.
    Gene Synonym:sFRP-1, AW011917, AW107218, AW742929, 2210415K03Rik
    Species:Mouse
    Vector:pCMV3-SP-N-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SFRP1 qPCR primers for gene expression analysis, MP200033 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    Secreted frizzled-related protein 1, also known as sFRP1, is a 35 kDa prototypical member of the SFRP family. SFRP family consists of five secreted glycoproteins in humans acting as extracellular signaling ligands. Each is approximately 300 amino acids in length and contains a cysteine-rich domain (CRD) that shares 30-50% sequence homology with the CRD of Frizzled (Fz) receptors, a putative signal sequence, and a conserved hydrophilic carboxy-terminal domain. SFRPs act as soluble modulators of Wnt signaling, counteracting Wnt-induced effects at high concentrations and promoting them at lower concentrations. SFRPs are able to bind Wnt proteins and Fz receptors in the extracellular compartment. The interaction between SFRPs and Wnt proteins prevents the latter from binding the Fz receptors. The Wnt pathway plays a key role in embryonic development, cell differentiation and cell proliferation. The deregulation of this critical developmental pathway occurs in several human tumor entities. Mouse sFRP1 is highly expressed in kidney and embryonic heart, as well as in the eye, where it is principally localized to the ciliary body and the lens epithelium.

    Size / Price
    Catalog: MG50033-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"