ZUFSP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51712-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ZUFSP Reagents
CRO Services
Product recommended

All ZUFSP Reagents
ZUFSP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1734 bp
Description
Full length Clone DNA of Mouse zinc finger with UFM1-specific peptidase domain with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ZUFSP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
2700019D07Rik cDNA ORF Clone, Mouse
ZUFSP Background Information
Full Name
zinc finger with UFM1-specific peptidase domain

ZUFSP cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ZUFSP cDNA ORF Clone in Cloning Vector, Rat RG80821-U
ZUFSP cDNA ORF Clone, Rat, untagged RG80821-UT
ZUFSP Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80821-ACGLN
ZUFSP cDNA ORF Clone, Rat, C-GFPSpark® tag RG80821-ACG
ZUFSP cDNA ORF Clone, Rat, N-GFPSpark® tag RG80821-ANG
ZUFSP cDNA ORF Clone, Rat, C-OFPSpark® tag RG80821-ACR
ZUFSP cDNA ORF Clone, Rat, N-OFPSpark® tag RG80821-ANR
ZUFSP cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80821-CF
ZUFSP cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80821-NF
ZUFSP cDNA ORF Clone, Rat, C-His tag RG80821-CH
ZUFSP cDNA ORF Clone, Rat, N-His tag RG80821-NH
ZUFSP cDNA ORF Clone, Rat, C-HA tag RG80821-CY
ZUFSP cDNA ORF Clone, Rat, N-HA tag RG80821-NY
ZUFSP cDNA ORF Clone, Rat, C-Myc tag RG80821-CM
ZUFSP cDNA ORF Clone, Rat, N-Myc tag RG80821-NM
ZUFSP qPCR Primer Pairs, Rat RP300785

ZUFSP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ZUFSP cDNA ORF Clone in Cloning Vector, Mouse MG51712-U
ZUFSP cDNA ORF Clone, Mouse, untagged MG51712-UT
ZUFSP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51712-ACGLN
ZUFSP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51712-ACG
ZUFSP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51712-ANG
ZUFSP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51712-ACR
ZUFSP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51712-ANR
ZUFSP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51712-NF
ZUFSP cDNA ORF Clone, Mouse, C-His tag MG51712-CH
ZUFSP cDNA ORF Clone, Mouse, N-His tag MG51712-NH
ZUFSP cDNA ORF Clone, Mouse, C-HA tag MG51712-CY
ZUFSP cDNA ORF Clone, Mouse, N-HA tag MG51712-NY
ZUFSP cDNA ORF Clone, Mouse, C-Myc tag MG51712-CM
ZUFSP cDNA ORF Clone, Mouse, N-Myc tag MG51712-NM
ZUFSP qPCR Primer Pairs, Mouse MP201585
info info
添加购物车成功! 添加购物车失败!