ZRANB2 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51881-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ZRANB2 Reagents
CRO Services
Product recommended

All ZRANB2 Reagents
ZRANB2 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
993 bp
Description
Full length Clone DNA of Mouse zinc finger, RAN-binding domain containing 2
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ZRANB2 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
AI227013 cDNA ORF Clone, Mouse;Zfp265 cDNA ORF Clone, Mouse;Zis cDNA ORF Clone, Mouse;Znf265 cDNA ORF Clone, Mouse
ZRANB2 Background Information
Full Name
zinc finger, RAN-binding domain containing 2

ZRANB2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ZRANB2 cDNA ORF Clone in Cloning Vector, Mouse MG51881-U
ZRANB2 cDNA ORF Clone, Mouse, untagged MG51881-UT
ZRANB2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51881-ACG
ZRANB2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51881-ACGLN
ZRANB2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51881-ANG
ZRANB2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51881-ACR
ZRANB2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51881-ANR
ZRANB2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51881-CF
ZRANB2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51881-NF
ZRANB2 cDNA ORF Clone, Mouse, C-His tag MG51881-CH
ZRANB2 cDNA ORF Clone, Mouse, N-His tag MG51881-NH
ZRANB2 cDNA ORF Clone, Mouse, N-HA tag MG51881-NY
ZRANB2 cDNA ORF Clone, Mouse, C-Myc tag MG51881-CM
ZRANB2 cDNA ORF Clone, Mouse, N-Myc tag MG51881-NM
ZRANB2 qPCR Primer Pairs, Mouse MP201754

ZRANB2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ZRANB2 cDNA ORF Clone in Cloning Vector, Human HG20897-U
ZRANB2 cDNA ORF Clone, Human, untagged HG20897-UT
ZRANB2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG20897-ACGLN
ZRANB2 cDNA ORF Clone, Human, C-GFPSpark® tag HG20897-ACG
ZRANB2 cDNA ORF Clone, Human, N-GFPSpark® tag HG20897-ANG
ZRANB2 cDNA ORF Clone, Human, C-OFPSpark® tag HG20897-ACR
ZRANB2 cDNA ORF Clone, Human, N-OFPSpark® tag HG20897-ANR
ZRANB2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG20897-CF
ZRANB2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG20897-NF
ZRANB2 cDNA ORF Clone, Human, C-His tag HG20897-CH
ZRANB2 cDNA ORF Clone, Human, N-His tag HG20897-NH
ZRANB2 cDNA ORF Clone, Human, C-HA tag HG20897-CY
ZRANB2 cDNA ORF Clone, Human, N-HA tag HG20897-NY
ZRANB2 cDNA ORF Clone, Human, C-Myc tag HG20897-CM
ZRANB2 cDNA ORF Clone, Human, N-Myc tag HG20897-NM
info info
添加购物车成功! 添加购物车失败!