ZFP90 cDNA ORF Clone, Mouse, C-His tag

Cat: MG51837-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ZFP90 Reagents
CRO Services
Product recommended

All ZFP90 Reagents
ZFP90 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1911 bp
Description
Full length Clone DNA of Mouse zinc finger protein 90 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ZFP90 cDNA ORF Clone, Mouse, C-His tag Alternative Names
6430515L01Rik cDNA ORF Clone, Mouse;KRAB17 cDNA ORF Clone, Mouse;mKIAA1954 cDNA ORF Clone, Mouse;NK10 cDNA ORF Clone, Mouse;Zfp64 cDNA ORF Clone, Mouse;Zfp83 cDNA ORF Clone, Mouse
ZFP90 Background Information
Full Name
ZFP90 zinc finger protein

ZFP90 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ZFP90 cDNA ORF Clone in Cloning Vector, Rat RG80871-U
ZFP90 cDNA ORF Clone, Rat, untagged RG80871-UT
ZFP90 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80871-ACG
ZFP90 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80871-ACGLN
ZFP90 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80871-ANG
ZFP90 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80871-ACR
ZFP90 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80871-ANR
ZFP90 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80871-CF
ZFP90 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80871-NF
ZFP90 cDNA ORF Clone, Rat, C-His tag RG80871-CH
ZFP90 cDNA ORF Clone, Rat, N-His tag RG80871-NH
ZFP90 cDNA ORF Clone, Rat, C-HA tag RG80871-CY
ZFP90 cDNA ORF Clone, Rat, N-HA tag RG80871-NY
ZFP90 cDNA ORF Clone, Rat, C-Myc tag RG80871-CM
ZFP90 cDNA ORF Clone, Rat, N-Myc tag RG80871-NM
ZFP90 qPCR Primer Pairs, Rat RP300835

ZFP90 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ZFP90 cDNA ORF Clone in Cloning Vector, Mouse MG51837-G
ZFP90 cDNA ORF Clone, Mouse, untagged MG51837-UT
ZFP90 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51837-ACGLN
ZFP90 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51837-ACG
ZFP90 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51837-ANG
ZFP90 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51837-ACR
ZFP90 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51837-ANR
ZFP90 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51837-CF
ZFP90 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51837-NF
ZFP90 cDNA ORF Clone, Mouse, N-His tag MG51837-NH
ZFP90 cDNA ORF Clone, Mouse, C-HA tag MG51837-CY
ZFP90 cDNA ORF Clone, Mouse, N-HA tag MG51837-NY
ZFP90 cDNA ORF Clone, Mouse, C-Myc tag MG51837-CM
ZFP90 cDNA ORF Clone, Mouse, N-Myc tag MG51837-NM
ZFP90 qPCR Primer Pairs, Mouse MP201710
info info
添加购物车成功! 添加购物车失败!