ZFAND6 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52114-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ZFAND6 Reagents
CRO Services
Product recommended

All ZFAND6 Reagents
ZFAND6 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
672 bp
Description
Full length Clone DNA of Mouse zinc finger, AN1-type domain 6 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ZFAND6 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
3110005P07Rik cDNA ORF Clone, Mouse;Awp1 cDNA ORF Clone, Mouse;Za20d3 cDNA ORF Clone, Mouse
ZFAND6 Background Information
Full Name
zinc finger, AN1-type domain 6

ZFAND6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ZFAND6 cDNA ORF Clone in Cloning Vector, Rat RG84597-U
ZFAND6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84597-ACGLN

ZFAND6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ZFAND6 cDNA ORF Clone in Cloning Vector, Mouse MG52114-G
ZFAND6 cDNA ORF Clone, Mouse, untagged MG52114-UT
ZFAND6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52114-ACGLN
ZFAND6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52114-ACG
ZFAND6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52114-ANG
ZFAND6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52114-ACR
ZFAND6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52114-ANR
ZFAND6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52114-CF
ZFAND6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52114-NF
ZFAND6 cDNA ORF Clone, Mouse, C-His tag MG52114-CH
ZFAND6 cDNA ORF Clone, Mouse, N-His tag MG52114-NH
ZFAND6 cDNA ORF Clone, Mouse, C-HA tag MG52114-CY
ZFAND6 cDNA ORF Clone, Mouse, C-Myc tag MG52114-CM
ZFAND6 cDNA ORF Clone, Mouse, N-Myc tag MG52114-NM
ZFAND6 qPCR Primer Pairs, Mouse MP201987

ZFAND6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ZFAND6 cDNA ORF Clone in Cloning Vector, Human HG13247-G
ZFAND6 cDNA ORF Clone, Human, untagged HG13247-UT
ZFAND6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13247-ACGLN
ZFAND6 cDNA ORF Clone, Human, C-GFPSpark® tag HG13247-ACG
ZFAND6 cDNA ORF Clone, Human, N-GFPSpark® tag HG13247-ANG
ZFAND6 cDNA ORF Clone, Human, C-OFPSpark® tag HG13247-ACR
ZFAND6 cDNA ORF Clone, Human, N-OFPSpark® tag HG13247-ANR
ZFAND6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13247-CF
ZFAND6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13247-NF
ZFAND6 cDNA ORF Clone, Human, C-His tag HG13247-CH
ZFAND6 cDNA ORF Clone, Human, N-His tag HG13247-NH
ZFAND6 cDNA ORF Clone, Human, C-HA tag HG13247-CY
ZFAND6 cDNA ORF Clone, Human, N-HA tag HG13247-NY
ZFAND6 cDNA ORF Clone, Human, C-Myc tag HG13247-CM
ZFAND6 cDNA ORF Clone, Human, N-Myc tag HG13247-NM
ZFAND6 qPCR Primer Pairs, Human HP101957
info info
添加购物车成功! 添加购物车失败!