14‑3‑3 / YWHAQ cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

14‑3‑3 / YWHAQ cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
738 bp
Description
Full length Clone DNA of Mouse tyrosine 3-monooxygenase>tryptophan 5-monooxygenase activation protein, theta polypeptide.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

14‑3‑3 / YWHAQ cDNA ORF Clone, Mouse, untagged: Alternative Names

2700028P07Rik cDNA ORF Clone, Mouse; AA409740 cDNA ORF Clone, Mouse; AU021156 cDNA ORF Clone, Mouse; R74690 cDNA ORF Clone, Mouse

14‑3‑3 / YWHAQ Background Information

The recently identified 14-3-3 tau, whose corresponding gene name is YWHAQ, is in a hypoxia-treated human trophoblast cell line. YWHAQ may play a role in epigenetic regulation of placental genes in the onset of Preeclampsia (PE). Moreover, there was a closer relationship between blood pressure and methylation levels of the YWHAQ promoter.
Full Name
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta
References
  • Cheng Y, et al. (2010) Effect of 14-3-3 tau protein on differentiation in BeWo choriocarcinoma cells. Placenta. 31(1): 60-6.
  • Umahara T, et al. (2010) 14-3-3 proteins and spinocerebellar ataxia type 1: from molecular interaction to human neuropathology. Cerebellum. 9(2): 183-9.
  • Wang B, et al. (2004) A role for 14-3-3 tau in E2F1 stabilization and DNA damage-induced apoptosis. J Biol Chem. 279(52): 54140-52.

14‑3‑3 / YWHAQ cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait