YPEL5 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51830-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All YPEL5 Reagents
CRO Services
Product recommended

All YPEL5 Reagents
YPEL5 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
366 bp
Description
Full length Clone DNA of Mouse yippee-like 5 (Drosophila)
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

YPEL5 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
2310076K21Rik cDNA ORF Clone, Mouse;CGI-127 cDNA ORF Clone, Mouse
YPEL5 Background Information
Full Name
yippee-like 5 (Drosophila)

YPEL5 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
YPEL5 cDNA ORF Clone in Cloning Vector, Rhesus CG90574-G
YPEL5 cDNA ORF Clone, Rhesus, untagged CG90574-UT
YPEL5 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90574-ACG
YPEL5 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90574-ACGLN
YPEL5 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90574-ANG
YPEL5 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90574-ACR
YPEL5 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90574-ANR
YPEL5 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90574-CF
YPEL5 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90574-NF
YPEL5 cDNA ORF Clone, Rhesus, C-His tag CG90574-CH
YPEL5 cDNA ORF Clone, Rhesus, N-His tag CG90574-NH
YPEL5 cDNA ORF Clone, Rhesus, C-HA tag CG90574-CY
YPEL5 cDNA ORF Clone, Rhesus, N-HA tag CG90574-NY
YPEL5 cDNA ORF Clone, Rhesus, C-Myc tag CG90574-CM
YPEL5 cDNA ORF Clone, Rhesus, N-Myc tag CG90574-NM

YPEL5 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
YPEL5 cDNA ORF Clone in Cloning Vector, Rat RG81688-G
YPEL5 cDNA ORF Clone, Rat, untagged RG81688-UT
YPEL5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81688-ACG
YPEL5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81688-ACGLN
YPEL5 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81688-ANG
YPEL5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81688-ACR
YPEL5 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81688-ANR
YPEL5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81688-CF
YPEL5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81688-NF
YPEL5 cDNA ORF Clone, Rat, C-His tag RG81688-CH
YPEL5 cDNA ORF Clone, Rat, N-His tag RG81688-NH
YPEL5 cDNA ORF Clone, Rat, C-HA tag RG81688-CY
YPEL5 cDNA ORF Clone, Rat, N-HA tag RG81688-NY
YPEL5 cDNA ORF Clone, Rat, C-Myc tag RG81688-CM
YPEL5 cDNA ORF Clone, Rat, N-Myc tag RG81688-NM

YPEL5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
YPEL5 cDNA ORF Clone in Cloning Vector, Mouse MG51830-U
YPEL5 cDNA ORF Clone, Mouse, untagged MG51830-UT
YPEL5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51830-ACG
YPEL5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51830-ACGLN
YPEL5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51830-ANG
YPEL5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51830-ACR
YPEL5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51830-ANR
YPEL5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51830-CF
YPEL5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51830-NF
YPEL5 cDNA ORF Clone, Mouse, C-His tag MG51830-CH
YPEL5 cDNA ORF Clone, Mouse, N-His tag MG51830-NH
YPEL5 cDNA ORF Clone, Mouse, N-HA tag MG51830-NY
YPEL5 cDNA ORF Clone, Mouse, C-Myc tag MG51830-CM
YPEL5 cDNA ORF Clone, Mouse, N-Myc tag MG51830-NM
YPEL5 qPCR Primer Pairs, Mouse MP201703

YPEL5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
YPEL5 cDNA ORF Clone in Cloning Vector, Human HG16778-U
YPEL5 cDNA ORF Clone, Human, untagged HG16778-UT
YPEL5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16778-ACGLN
YPEL5 cDNA ORF Clone, Human, C-GFPSpark® tag HG16778-ACG
YPEL5 cDNA ORF Clone, Human, N-GFPSpark® tag HG16778-ANG
YPEL5 cDNA ORF Clone, Human, C-OFPSpark® tag HG16778-ACR
YPEL5 cDNA ORF Clone, Human, N-OFPSpark® tag HG16778-ANR
YPEL5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16778-CF
YPEL5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16778-NF
YPEL5 cDNA ORF Clone, Human, C-His tag HG16778-CH
YPEL5 cDNA ORF Clone, Human, N-His tag HG16778-NH
YPEL5 cDNA ORF Clone, Human, C-HA tag HG16778-CY
YPEL5 cDNA ORF Clone, Human, N-HA tag HG16778-NY
YPEL5 cDNA ORF Clone, Human, C-Myc tag HG16778-CM
YPEL5 cDNA ORF Clone, Human, N-Myc tag HG16778-NM
info info
添加购物车成功! 添加购物车失败!