YEATS4 cDNA ORF Clone, Mouse, untagged

Cat: MG51442-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All YEATS4 Reagents
CRO Services
Product recommended

All YEATS4 Reagents
YEATS4 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
684 bp
Description
Full length Clone DNA of Mouse YEATS domain containing 4.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

YEATS4 cDNA ORF Clone, Mouse, untagged Alternative Names
4930573H17Rik cDNA ORF Clone, Mouse;B230215M10Rik cDNA ORF Clone, Mouse;GAS41 cDNA ORF Clone, Mouse;NuBI-1 cDNA ORF Clone, Mouse
YEATS4 Background Information
Full Name
YEATS domain containing 4

YEATS4 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
YEATS4 cDNA ORF Clone in Cloning Vector, Ferret FG60117-G
YEATS4 cDNA ORF Clone, Ferret, untagged FG60117-UT
YEATS4 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60117-ACGLN
YEATS4 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60117-ACG
YEATS4 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60117-ANG
YEATS4 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60117-ACR
YEATS4 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60117-ANR
YEATS4 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60117-CF
YEATS4 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60117-NF
YEATS4 cDNA ORF Clone, Ferret, C-His tag FG60117-CH
YEATS4 cDNA ORF Clone, Ferret, N-His tag FG60117-NH
YEATS4 cDNA ORF Clone, Ferret, C-HA tag FG60117-CY
YEATS4 cDNA ORF Clone, Ferret, N-HA tag FG60117-NY
YEATS4 cDNA ORF Clone, Ferret, C-Myc tag FG60117-CM
YEATS4 cDNA ORF Clone, Ferret, N-Myc tag FG60117-NM

YEATS4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
YEATS4 cDNA ORF Clone in Cloning Vector, Rat RG88503-U
YEATS4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG88503-ACGLN

YEATS4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
YEATS4 cDNA ORF Clone in Cloning Vector, Mouse MG51442-G
YEATS4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51442-ACG
YEATS4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51442-ACGLN
YEATS4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51442-ANG
YEATS4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51442-ACR
YEATS4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51442-ANR
YEATS4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51442-CF
YEATS4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51442-NF
YEATS4 cDNA ORF Clone, Mouse, C-His tag MG51442-CH
YEATS4 cDNA ORF Clone, Mouse, N-His tag MG51442-NH
YEATS4 cDNA ORF Clone, Mouse, C-HA tag MG51442-CY
YEATS4 cDNA ORF Clone, Mouse, N-HA tag MG51442-NY
YEATS4 cDNA ORF Clone, Mouse, C-Myc tag MG51442-CM
YEATS4 cDNA ORF Clone, Mouse, N-Myc tag MG51442-NM
YEATS4 qPCR Primer Pairs, Mouse MP201326

YEATS4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
YEATS4 cDNA ORF Clone in Cloning Vector, Human HG17649-U
YEATS4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17649-ACGLN
info info
添加购物车成功! 添加购物车失败!