YB-1 / YBX1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG51594-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All YB-1 / YBX1 Reagents
CRO Services
Product recommended

All YB-1 / YBX1 Reagents
YB-1 / YBX1 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1014 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse Y box protein 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Restriction Sites
KpnI + XbaI(6kb+1.01kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
YB-1 / YBX1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

YB-1 / YBX1 cDNA ORF Clone, Mouse, N-Myc tag Validated Images
Human bFGF/FGF2 Gene Plasmid Map 5639
YB-1 / YBX1 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
1700102N10Rik cDNA ORF Clone, Mouse;C79409 cDNA ORF Clone, Mouse;dbpB cDNA ORF Clone, Mouse;EF1A cDNA ORF Clone, Mouse;MSY1 cDNA ORF Clone, Mouse;mYB-1a cDNA ORF Clone, Mouse;Nsep1 cDNA ORF Clone, Mouse;YB-1 cDNA ORF Clone, Mouse
YB-1 / YBX1 Background Information
Full Name
Y box binding protein 1

YB-1 / YBX1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
YB-1 / YBX1 cDNA ORF Clone in Cloning Vector, Mouse MG51594-U
YB-1 / YBX1 cDNA ORF Clone, Mouse, untagged MG51594-UT
YB-1 / YBX1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51594-ACG
YB-1 / YBX1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51594-ACGLN
YB-1 / YBX1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51594-ANG
YB-1 / YBX1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51594-ACR
YB-1 / YBX1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51594-ANR
YB-1 / YBX1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51594-CF
YB-1 / YBX1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51594-NF
YB-1 / YBX1 cDNA ORF Clone, Mouse, C-His tag MG51594-CH
YB-1 / YBX1 cDNA ORF Clone, Mouse, N-His tag MG51594-NH
YB-1 / YBX1 cDNA ORF Clone, Mouse, C-HA tag MG51594-CY
YB-1 / YBX1 cDNA ORF Clone, Mouse, N-HA tag MG51594-NY
YB-1 / YBX1 cDNA ORF Clone, Mouse, C-Myc tag MG51594-CM
YB-1 / YBX1 qPCR Primer Pairs, Mouse MP201477

YB-1 / YBX1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
YB-1 / YBX1 cDNA ORF Clone in Cloning Vector, Human HG17046-U
YB-1 / YBX1 cDNA ORF Clone, Human, untagged HG17046-UT
YB-1 / YBX1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17046-ACGLN
YB-1 / YBX1 cDNA ORF Clone, Human, C-GFPSpark® tag HG17046-ACG
YB-1 / YBX1 cDNA ORF Clone, Human, N-GFPSpark® tag HG17046-ANG
YB-1 / YBX1 cDNA ORF Clone, Human, C-OFPSpark® tag HG17046-ACR
YB-1 / YBX1 cDNA ORF Clone, Human, N-OFPSpark® tag HG17046-ANR
YB-1 / YBX1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17046-CF
YB-1 / YBX1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17046-NF
YB-1 / YBX1 cDNA ORF Clone, Human, C-His tag HG17046-CH
YB-1 / YBX1 cDNA ORF Clone, Human, N-His tag HG17046-NH
YB-1 / YBX1 cDNA ORF Clone, Human, C-HA tag HG17046-CY
YB-1 / YBX1 cDNA ORF Clone, Human, N-HA tag HG17046-NY
YB-1 / YBX1 cDNA ORF Clone, Human, C-Myc tag HG17046-CM
YB-1 / YBX1 cDNA ORF Clone, Human, N-Myc tag HG17046-NM
info info
添加购物车成功! 添加购物车失败!