XIAP cDNA ORF Clone, Mouse, N-His tag

Cat: MG50802-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All XIAP Reagents
CRO Services
Product recommended

All XIAP Reagents
XIAP cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1491 bp
Description
Full length Clone DNA of Mouse X-linked inhibitor of apoptosis with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

XIAP cDNA ORF Clone, Mouse, N-His tag Alternative Names
1110015C02Rik cDNA ORF Clone, Mouse;Aipa cDNA ORF Clone, Mouse;Api3 cDNA ORF Clone, Mouse;Birc4 cDNA ORF Clone, Mouse;IAP3 cDNA ORF Clone, Mouse;ILP-1 cDNA ORF Clone, Mouse;MIHA cDNA ORF Clone, Mouse
XIAP Background Information

E3 ubiquitin-protein ligase XIAP / BIRC4, also known as inhibitor of apoptosis protein 3, X-linked inhibitor of apoptosis protein, and IAP-like protein, is a protein that belongs to a family of apoptotic suppressor proteins. Members of this family share a conserved motif termed, baculovirus IAP repeat, which is necessary for their anti-apoptotic function. XIAP / BIRC4 functions through binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2 and inhibits apoptosis induced by menadione, a potent inducer of free radicals, and interleukin 1-beta converting enzyme. XIAP / BIRC4 also inhibits at least two members of the caspase family of cell-death proteases, caspase-3 and caspase-7. Mutations in this encoding gene are the cause of X-linked lymphoproliferative syndrome. Alternate splicing results in multiple transcript variants. Thought to be the most potent apoptosis suppressor, XIAP / BIRC4, directly binds and inhibits caspases -3, -7 and -9. Survivin, which also binds to several caspases, is up-regulated in a many tumour cell types. Defects in XIAP / BIRC4 are the cause of lymphoproliferative syndrome X-linked type 2 (XLP2). XLP is a rare immunodeficiency characterized by extreme susceptibility to infection with Epstein-Barr virus (EBV). Symptoms include severe or fatal mononucleosis, acquired hypogammaglobulinemia, pancytopenia and malignant lymphoma.

Full Name
X-linked inhibitor of apoptosis, E3 ubiquitin protein ligase
References
  • Holcik M, et al. (2000) Functional Characterization of the X-Linked Inhibitor of Apoptosis (XIAP) Internal Ribosome Entry Site Element: Role of La Autoantigen in XIAP Translation. Mol Cell Biol. 20 (13): 4648-57.
  • Winsauer G, et al. (2008) XIAP regulates bi-phasic NF-kappaB induction involving physical interaction and ubiquitination of MEKK2. Cell Signal. 20 (11): 2107-12.
  • Suzuki Y, et al. (2001) X-linked inhibitor of apoptosis protein (XIAP) inhibits caspase-3 and -7 in distinct modes. J Biol Chem. 276 (29): 27058-63.
  • XIAP cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    XIAP cDNA ORF Clone in Cloning Vector, Rat RG82310-U
    XIAP Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82310-ACGLN

    XIAP cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    XIAP cDNA ORF Clone in Cloning Vector, Mouse MG50802-G
    XIAP cDNA ORF Clone, Mouse, untagged MG50802-UT
    XIAP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50802-ACG
    XIAP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50802-ACGLN
    XIAP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50802-ANG
    XIAP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50802-ACR
    XIAP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50802-ANR
    XIAP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50802-CF
    XIAP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50802-NF
    XIAP cDNA ORF Clone, Mouse, C-His tag MG50802-CH
    XIAP cDNA ORF Clone, Mouse, C-HA tag MG50802-CY
    XIAP cDNA ORF Clone, Mouse, N-HA tag MG50802-NY
    XIAP cDNA ORF Clone, Mouse, C-Myc tag MG50802-CM
    XIAP cDNA ORF Clone, Mouse, N-Myc tag MG50802-NM
    XIAP qPCR Primer Pairs, Mouse MP200773

    XIAP cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    XIAP cDNA ORF Clone in Cloning Vector, Human HG10606-M
    XIAP cDNA ORF Clone, Human, untagged HG10606-UT
    XIAP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10606-ACGLN
    XIAP cDNA ORF Clone, Human, C-GFPSpark® tag HG10606-ACG
    XIAP cDNA ORF Clone, Human, N-GFPSpark® tag HG10606-ANG
    XIAP cDNA ORF Clone, Human, C-OFPSpark® tag HG10606-ACR
    XIAP cDNA ORF Clone, Human, N-OFPSpark® tag HG10606-ANR
    XIAP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10606-CF
    XIAP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10606-NF
    XIAP cDNA ORF Clone, Human, C-His tag HG10606-CH
    XIAP cDNA ORF Clone, Human, N-His tag HG10606-NH
    XIAP cDNA ORF Clone, Human, C-HA tag HG10606-CY
    XIAP cDNA ORF Clone, Human, N-HA tag HG10606-NY
    XIAP cDNA ORF Clone, Human, C-Myc tag HG10606-CM
    XIAP cDNA ORF Clone, Human, N-Myc tag HG10606-NM
    XIAP qPCR Primer Pairs, Human HP100593
    info info
    添加购物车成功! 添加购物车失败!