WWP2 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52851-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All WWP2 Reagents
CRO Services
Product recommended

All WWP2 Reagents
WWP2 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2613 bp
Description
Full length Clone DNA of Mouse WW domain containing E3 ubiquitin protein ligase 2 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

WWP2 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
1300010O06Rik cDNA ORF Clone, Mouse;AA690238 cDNA ORF Clone, Mouse;AIP2 cDNA ORF Clone, Mouse;AW554328 cDNA ORF Clone, Mouse
WWP2 Background Information

WWP2 contains 1 C2 domain, 1 HECT (E6AP-type E3 ubiquitin-protein ligase) domain and 4 WW domains. It is an E3 ubiquitin-protein ligase which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates. WWP2 can be detected in heart, throughout the brain, placenta, lung, liver, muscle, kidney and pancreas. It is also expressed in spleen and peripheral blood leukocytes. WWP2 polyubiquitinates POU5F1 by 'Lys-63'-linked conjugation and promotes it to proteasomal degradation; in embryonic stem cells (ESCs) the ubiquitination is proposed to regulate POU5F1 protein level. WWP2 ubiquitinates EGR2 and promotes it to proteasomal degradation; in T-cells the ubiquitination inhibits activation-induced cell death. It also ubiquitinates SLC11A2; the ubiquitination is enhanced by presence of NDFIP1 and NDFIP2. WWP2 ubiquitinates RPB1 and promotes it to proteasomal degradation.

Full Name
WW domain containing E3 ubiquitin protein ligase 2
References
  • McDonald FJ, et al. (2002) Ubiquitin-protein ligase WWP2 binds to and downregulates the epithelial Na(+) channel. Am J Physiol Renal Physiol. 283 (3): F431-6.
  • Soond SM, et al. (2011) Selective targeting of activating and inhibitory Smads by distinct WWP2 ubiquitin ligase isoforms differentially modulates TGFβ signalling and EMT. Oncogene. 30 (21): 2451-62.
  • Marcucci R, et al. (2011) Pin1 and WWP2 regulate GluR2 Q/R site RNA editing by ADAR2 with opposing effects. EMBO J. 30 (20): 4211-22.
  • Maddika S, et al. (2011) WWP2 is an E3 ubiquitin ligase for PTEN. Nat Cell Biol. 13 (6): 728-33.
  • Xu H, et al. (2009) WWP2 promotes degradation of transcription factor OCT4 in human embryonic stem cells. Cell Res. 19 (5): 561-73.
  • WWP2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    WWP2 cDNA ORF Clone in Cloning Vector, Mouse MG52851-U
    WWP2 cDNA ORF Clone, Mouse, untagged MG52851-UT
    WWP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52851-ACG
    WWP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52851-ACGLN
    WWP2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52851-ANG
    WWP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52851-ACR
    WWP2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52851-ANR
    WWP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52851-CF
    WWP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52851-NF
    WWP2 cDNA ORF Clone, Mouse, C-His tag MG52851-CH
    WWP2 cDNA ORF Clone, Mouse, N-His tag MG52851-NH
    WWP2 cDNA ORF Clone, Mouse, C-HA tag MG52851-CY
    WWP2 cDNA ORF Clone, Mouse, C-Myc tag MG52851-CM
    WWP2 cDNA ORF Clone, Mouse, N-Myc tag MG52851-NM

    WWP2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    WWP2 cDNA ORF Clone in Cloning Vector, Human HG13125-G
    WWP2 cDNA ORF Clone, Human, untagged HG12393-UT
    WWP2 cDNA ORF Clone, Human, untagged HG13125-UT
    WWP2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13125-ACG
    WWP2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12393-ACGLN
    WWP2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13125-ACGLN
    WWP2 cDNA ORF Clone, Human, N-GFPSpark® tag HG13125-ANG
    WWP2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13125-ACR
    WWP2 cDNA ORF Clone, Human, N-OFPSpark® tag HG13125-ANR
    WWP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13125-CF
    WWP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13125-NF
    WWP2 cDNA ORF Clone, Human, C-His tag HG13125-CH
    WWP2 cDNA ORF Clone, Human, N-His tag HG13125-NH
    WWP2 cDNA ORF Clone, Human, C-HA tag HG13125-CY
    WWP2 cDNA ORF Clone, Human, N-HA tag HG13125-NY
    WWP2 cDNA ORF Clone, Human, C-Myc tag HG13125-CM
    WWP2 cDNA ORF Clone, Human, N-Myc tag HG13125-NM
    WWP2 qPCR Primer Pairs, Human HP101745
    info info
    添加购物车成功! 添加购物车失败!