Quick Order

Mouse WWP2 ORF mammalian expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Mouse WWP2 cDNA Clone Product Information
NCBI RefSeq:NM_025830.3
RefSeq ORF Size:2613bp
cDNA Description:Full length Clone DNA of Mus musculus WW domain containing E3 ubiquitin protein ligase 2 with C terminal Flag tag.
Gene Synonym:AIP2, AA690238, AW554328, 1300010O06Rik
Species:Mouse
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

WWP2 contains 1 C2 domain, 1 HECT (E6AP-type E3 ubiquitin-protein ligase) domain and 4 WW domains. It is an E3 ubiquitin-protein ligase which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates. WWP2 can be detected in heart, throughout the brain, placenta, lung, liver, muscle, kidney and pancreas. It is also expressed in spleen and peripheral blood leukocytes. WWP2 polyubiquitinates POU5F1 by 'Lys-63'-linked conjugation and promotes it to proteasomal degradation; in embryonic stem cells (ESCs) the ubiquitination is proposed to regulate POU5F1 protein level. WWP2 ubiquitinates EGR2 and promotes it to proteasomal degradation; in T-cells the ubiquitination inhibits activation-induced cell death. It also ubiquitinates SLC11A2; the ubiquitination is enhanced by presence of NDFIP1 and NDFIP2. WWP2 ubiquitinates RPB1 and promotes it to proteasomal degradation.

References
  • McDonald FJ, et al. (2002) Ubiquitin-protein ligase WWP2 binds to and downregulates the epithelial Na(+) channel. Am J Physiol Renal Physiol. 283 (3): F431-6.
  • Soond SM, et al. (2011) Selective targeting of activating and inhibitory Smads by distinct WWP2 ubiquitin ligase isoforms differentially modulates TGFβ signalling and EMT. Oncogene. 30 (21): 2451-62.
  • Marcucci R, et al. (2011) Pin1 and WWP2 regulate GluR2 Q/R site RNA editing by ADAR2 with opposing effects. EMBO J. 30 (20): 4211-22.
  • Maddika S, et al. (2011) WWP2 is an E3 ubiquitin ligase for PTEN. Nat Cell Biol. 13 (6): 728-33.
  • Xu H, et al. (2009) WWP2 promotes degradation of transcription factor OCT4 in human embryonic stem cells. Cell Res. 19 (5): 561-73.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"