WDR5 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50609-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All WDR5 Reagents
CRO Services
Product recommended

All WDR5 Reagents
WDR5 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1005 bp
Description
Full length Clone DNA of Mouse WD repeat domain 5 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

WDR5 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
2410008O07Rik cDNA ORF Clone, Mouse;AA408785 cDNA ORF Clone, Mouse;AA960360 cDNA ORF Clone, Mouse;Big cDNA ORF Clone, Mouse;Big-3 cDNA ORF Clone, Mouse
WDR5 Background Information
Full Name
WD repeat domain 5

WDR5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
WDR5 cDNA ORF Clone in Cloning Vector, Mouse MG50609-M
WDR5 cDNA ORF Clone, Mouse, untagged MG50609-UT
WDR5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50609-ACG
WDR5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50609-ACGLN
WDR5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50609-ANG
WDR5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50609-ACR
WDR5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50609-ANR
WDR5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50609-CF
WDR5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50609-NF
WDR5 cDNA ORF Clone, Mouse, C-His tag MG50609-CH
WDR5 cDNA ORF Clone, Mouse, N-His tag MG50609-NH
WDR5 cDNA ORF Clone, Mouse, C-HA tag MG50609-CY
WDR5 cDNA ORF Clone, Mouse, C-Myc tag MG50609-CM
WDR5 cDNA ORF Clone, Mouse, N-Myc tag MG50609-NM
WDR5 qPCR Primer Pairs, Mouse MP200595

WDR5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
WDR5 cDNA ORF Clone in Cloning Vector, Human HG12368-U
WDR5 cDNA ORF Clone, Human, untagged HG12368-UT
WDR5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12368-ACGLN
WDR5 cDNA ORF Clone, Human, C-GFPSpark® tag HG12368-ACG
WDR5 cDNA ORF Clone, Human, N-GFPSpark® tag HG12368-ANG
WDR5 cDNA ORF Clone, Human, C-OFPSpark® tag HG12368-ACR
WDR5 cDNA ORF Clone, Human, N-OFPSpark® tag HG12368-ANR
WDR5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12368-CF
WDR5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12368-NF
WDR5 cDNA ORF Clone, Human, C-His tag HG12368-CH
WDR5 cDNA ORF Clone, Human, N-His tag HG12368-NH
WDR5 cDNA ORF Clone, Human, C-HA tag HG12368-CY
WDR5 cDNA ORF Clone, Human, N-HA tag HG12368-NY
WDR5 cDNA ORF Clone, Human, C-Myc tag HG12368-CM
WDR5 cDNA ORF Clone, Human, N-Myc tag HG12368-NM
WDR5 qPCR Primer Pairs, Human HP104729
info info
添加购物车成功! 添加购物车失败!