WDR43 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG53011-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All WDR43 Reagents
CRO Services
Product recommended

All WDR43 Reagents
WDR43 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2034 bp
Description
Full length Clone DNA of Mouse WD repeat domain 43 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

WDR43 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
2610318G08Rik cDNA ORF Clone, Mouse;AU020887 cDNA ORF Clone, Mouse;AV024208 cDNA ORF Clone, Mouse;mKIAA0007 cDNA ORF Clone, Mouse;Wrd43 cDNA ORF Clone, Mouse
WDR43 Background Information
Full Name
WD repeat domain 43

WDR43 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
WDR43 cDNA ORF Clone in Cloning Vector, Mouse MG53011-G
WDR43 cDNA ORF Clone, Mouse, untagged MG53011-UT
WDR43 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53011-ACGLN
WDR43 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53011-ACG
WDR43 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53011-ANG
WDR43 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53011-ACR
WDR43 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53011-ANR
WDR43 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53011-CF
WDR43 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53011-NF
WDR43 cDNA ORF Clone, Mouse, C-His tag MG53011-CH
WDR43 cDNA ORF Clone, Mouse, N-His tag MG53011-NH
WDR43 cDNA ORF Clone, Mouse, C-HA tag MG53011-CY
WDR43 cDNA ORF Clone, Mouse, N-HA tag MG53011-NY
WDR43 cDNA ORF Clone, Mouse, N-Myc tag MG53011-NM

WDR43 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
WDR43 cDNA ORF Clone in Cloning Vector, Human HG24038-U
WDR43 cDNA ORF Clone, Human, untagged HG24038-UT
WDR43 cDNA ORF Clone, Human, C-GFPSpark® tag HG24038-ACG
WDR43 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG24038-ACGLN
WDR43 cDNA ORF Clone, Human, N-GFPSpark® tag HG24038-ANG
WDR43 cDNA ORF Clone, Human, C-OFPSpark® tag HG24038-ACR
WDR43 cDNA ORF Clone, Human, N-OFPSpark® tag HG24038-ANR
WDR43 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG24038-CF
WDR43 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG24038-NF
WDR43 cDNA ORF Clone, Human, C-His tag HG24038-CH
WDR43 cDNA ORF Clone, Human, N-His tag HG24038-NH
WDR43 cDNA ORF Clone, Human, C-HA tag HG24038-CY
WDR43 cDNA ORF Clone, Human, N-HA tag HG24038-NY
WDR43 cDNA ORF Clone, Human, C-Myc tag HG24038-CM
WDR43 cDNA ORF Clone, Human, N-Myc tag HG24038-NM
info info
添加购物车成功! 添加购物车失败!