WDR3 cDNA ORF Clone, Mouse, N-His tag

Cat: MG53046-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All WDR3 Reagents
CRO Services
Product recommended

All WDR3 Reagents
WDR3 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2829 bp
Description
Full length Clone DNA of Mouse WD repeat domain 3 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

WDR3 cDNA ORF Clone, Mouse, N-His tag Alternative Names
AW546279 cDNA ORF Clone, Mouse;D030020G18Rik cDNA ORF Clone, Mouse
WDR3 Background Information
Full Name
WD repeat domain 3

WDR3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
WDR3 cDNA ORF Clone in Cloning Vector, Mouse MG53046-G
WDR3 cDNA ORF Clone, Mouse, untagged MG53046-UT
WDR3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53046-ACGLN
WDR3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53046-ACG
WDR3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53046-ANG
WDR3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53046-ACR
WDR3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53046-ANR
WDR3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53046-CF
WDR3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53046-NF
WDR3 cDNA ORF Clone, Mouse, C-His tag MG53046-CH
WDR3 cDNA ORF Clone, Mouse, C-HA tag MG53046-CY
WDR3 cDNA ORF Clone, Mouse, N-HA tag MG53046-NY
WDR3 cDNA ORF Clone, Mouse, C-Myc tag MG53046-CM
WDR3 cDNA ORF Clone, Mouse, N-Myc tag MG53046-NM

WDR3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
WDR3 cDNA ORF Clone in Cloning Vector, Human HG21033-U
WDR3 cDNA ORF Clone, Human, untagged HG21033-UT
WDR3 cDNA ORF Clone, Human, C-GFPSpark® tag HG21033-ACG
WDR3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21033-ACGLN
WDR3 cDNA ORF Clone, Human, N-GFPSpark® tag HG21033-ANG
WDR3 cDNA ORF Clone, Human, C-OFPSpark® tag HG21033-ACR
WDR3 cDNA ORF Clone, Human, N-OFPSpark® tag HG21033-ANR
WDR3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG21033-CF
WDR3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG21033-NF
WDR3 cDNA ORF Clone, Human, C-His tag HG21033-CH
WDR3 cDNA ORF Clone, Human, N-His tag HG21033-NH
WDR3 cDNA ORF Clone, Human, C-HA tag HG21033-CY
WDR3 cDNA ORF Clone, Human, N-HA tag HG21033-NY
WDR3 cDNA ORF Clone, Human, C-Myc tag HG21033-CM
WDR3 cDNA ORF Clone, Human, N-Myc tag HG21033-NM
info info
添加购物车成功! 添加购物车失败!