Quick Order

Mouse WARS / TrpRS Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse WARS cDNA Clone Product Information
NCBI RefSeq:NM_001164314.1
RefSeq ORF Size:1428bp
cDNA Description:Full length Clone DNA of Mus musculus tryptophanyl-tRNA synthetase with N terminal His tag.
Gene Synonym:WRS, TrpRS
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

WARS, also known as TrpRS, is an aminoacyl-tRNA synthetase which belongs to the class-I aminoacyl-tRNA synthetase family. There are two forms of tryptophanyl-tRNA synthetase: a cytoplasmic form, named WARS, and a mitochondrial form, named WARS2. They catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. WARS catalyzes the aminoacylation of tRNA(trp) with tryptophan and is induced by interferon.

References
  • Buwitt U. et al., 1992, EMBO J. 11 (2): 489-96.
  • Fleckner J. et al., 1992, Proc Natl Acad Sci. 88 (24): 11520-4.
  • Ewalt KL. et al., 2002, Biochemistry. 41 (45): 13344-9.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"