Vitronectin cDNA ORF Clone, Mouse, C-OFPSpark® tag

Price:
Size:
Number:

Vitronectin cDNA ORF Clone, Mouse, C-OFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1437 bp
Description
Full length Clone DNA of Mouse vitronectin with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Vitronectin cDNA ORF Clone, Mouse, C-OFPSpark® tag: Alternative Names

AI256434 cDNA ORF Clone, Mouse; Vn cDNA ORF Clone, Mouse

Vitronectin Background Information

Vitronectin, also known as VTN, is a member of the pexin family. It is an abundant glycoprotein found in serum the extracellular matrix and promotes cell adhesion and spreading. Vitronectin is a secreted protein and exists in either a single chain form or a cleaved, two chain form held together by a disulfide bond. Vitronectin is a plasma glycoprotein implicated as a regulator of diverse physiological process, including blood coagulation, fibrinolysis, pericellular proteolysis, complement dependent immune responses, and cell attachment and spreading. Because of its ability to bind platelet glycoproteins and mediate platelet adhesion and aggregation at sites of vascular injury, vitronectin has become an important mediator in the pathogenesis of coronary atherosclerosis. As a multifunctional protein with a multiple binding domain, Vitronectin interacts with a variety of plasma and cell proteins. Vitronectin binds multiple ligands, including the soluble vitronectin receptor. It may be an independent predictor of adverse cardiovascular outcomes following acute stenting. Accordingly, Vitronectin is suggested to be involved in hemostasis, cell migration, as well as tumor malignancy.
Full Name
vitronectin
References
  • Ekmeki OB, et al. (2006) Vitronectin in atherosclerotic disease. Clin Chim Acta. 368(1-2): 77-83.
  • Derer W, et al. (2009) Vitronectin concentrations predict risk in patients undergoing coronary stenting. Circ Cardiovasc Interv. 2(1): 14-9.
  • Heyman L, et al. (2010) Mesothelial vitronectin stimulates migration of ovarian cancer cells. Cell Biol Int. 34(5): 493-502.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait