VWC2L cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52055-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All VWC2L Reagents
CRO Services
Product recommended

All VWC2L Reagents
VWC2L cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
381 bp
Description
Full length Clone DNA of Mouse von Willebrand factor C domain-containing protein 2-like with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VWC2L cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
A830006F12Rik cDNA ORF Clone, Mouse;Brl cDNA ORF Clone, Mouse
VWC2L Background Information
Full Name
von Willebrand factor C domain containing protein 2-like

VWC2L cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
VWC2L cDNA ORF Clone in Cloning Vector, Mouse MG52055-G
VWC2L cDNA ORF Clone, Mouse, untagged MG52055-UT
VWC2L Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52055-ACGLN
VWC2L cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52055-ACG
VWC2L cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52055-ACR
VWC2L cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52055-CF
VWC2L cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52055-NF
VWC2L cDNA ORF Clone, Mouse, C-His tag MG52055-CH
VWC2L cDNA ORF Clone, Mouse, N-His tag MG52055-NH
VWC2L cDNA ORF Clone, Mouse, C-HA tag MG52055-CY
VWC2L cDNA ORF Clone, Mouse, N-HA tag MG52055-NY
VWC2L cDNA ORF Clone, Mouse, C-Myc tag MG52055-CM
VWC2L qPCR Primer Pairs, Mouse MP201928

VWC2L cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
VWC2L cDNA ORF Clone in Cloning Vector, Human HG14529-G
VWC2L cDNA ORF Clone, Human, untagged HG14529-UT
VWC2L Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14529-ACGLN
VWC2L cDNA ORF Clone, Human, C-GFPSpark® tag HG14529-ACG
VWC2L cDNA ORF Clone, Human, C-OFPSpark® tag HG14529-ACR
VWC2L cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14529-CF
VWC2L cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14529-NF
VWC2L cDNA ORF Clone, Human, C-His tag HG14529-CH
VWC2L cDNA ORF Clone, Human, N-His tag HG14529-NH
VWC2L cDNA ORF Clone, Human, C-HA tag HG14529-CY
VWC2L cDNA ORF Clone, Human, N-HA tag HG14529-NY
VWC2L cDNA ORF Clone, Human, C-Myc tag HG14529-CM
VWC2L cDNA ORF Clone, Human, N-Myc tag HG14529-NM
VWC2L qPCR Primer Pairs, Human HP103176
info info
添加购物车成功! 添加购物车失败!