VTA1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG53005-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All VTA1 Reagents
CRO Services
Product recommended

All VTA1 Reagents
VTA1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
930 bp
Description
Full length Clone DNA of Mouse Vps20-associated 1 homolog (S. cerevisiae) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VTA1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
1110001D18Rik cDNA ORF Clone, Mouse;1110059P08Rik cDNA ORF Clone, Mouse;AU040813 cDNA ORF Clone, Mouse;C85340 cDNA ORF Clone, Mouse;LIP5 cDNA ORF Clone, Mouse;SBP1 cDNA ORF Clone, Mouse
VTA1 Background Information
Full Name
vesicle (multivesicular body) trafficking 1

VTA1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
VTA1 cDNA ORF Clone in Cloning Vector, Rat RG87921-U
VTA1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87921-ACGLN

VTA1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
VTA1 cDNA ORF Clone in Cloning Vector, Mouse MG53005-G
VTA1 cDNA ORF Clone, Mouse, untagged MG53005-UT
VTA1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53005-ACGLN
VTA1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53005-ACG
VTA1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53005-ANG
VTA1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53005-ACR
VTA1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53005-ANR
VTA1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53005-CF
VTA1 cDNA ORF Clone, Mouse, C-His tag MG53005-CH
VTA1 cDNA ORF Clone, Mouse, N-His tag MG53005-NH
VTA1 cDNA ORF Clone, Mouse, C-HA tag MG53005-CY
VTA1 cDNA ORF Clone, Mouse, N-HA tag MG53005-NY
VTA1 cDNA ORF Clone, Mouse, C-Myc tag MG53005-CM
VTA1 cDNA ORF Clone, Mouse, N-Myc tag MG53005-NM

VTA1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
VTA1 cDNA ORF Clone in Cloning Vector, Human HG14705-G
VTA1 cDNA ORF Clone, Human, untagged HG14705-UT
VTA1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14705-ACGLN
VTA1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14705-ACG
VTA1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14705-ANG
VTA1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14705-ACR
VTA1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14705-ANR
VTA1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14705-CF
VTA1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14705-NF
VTA1 cDNA ORF Clone, Human, C-His tag HG14705-CH
VTA1 cDNA ORF Clone, Human, N-His tag HG14705-NH
VTA1 cDNA ORF Clone, Human, C-HA tag HG14705-CY
VTA1 cDNA ORF Clone, Human, N-HA tag HG14705-NY
VTA1 cDNA ORF Clone, Human, C-Myc tag HG14705-CM
VTA1 cDNA ORF Clone, Human, N-Myc tag HG14705-NM
VTA1 qPCR Primer Pairs, Human HP103339
info info
添加购物车成功! 添加购物车失败!