VRK3 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52617-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All VRK3 Reagents
CRO Services
Product recommended

All VRK3 Reagents
VRK3 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1362 bp
Description
Full length Clone DNA of Mouse vaccinia related kinase 3 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VRK3 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
AI428238 cDNA ORF Clone, Mouse
VRK3 Background Information
Full Name
vaccinia related kinase 3

VRK3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
VRK3 cDNA ORF Clone in Cloning Vector, Rat RG81422-G

VRK3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
VRK3 cDNA ORF Clone in Cloning Vector, Mouse MG52617-U
VRK3 cDNA ORF Clone, Mouse, untagged MG52617-UT
VRK3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52617-ACG
VRK3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52617-ACGLN
VRK3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52617-ANG
VRK3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52617-ACR
VRK3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52617-ANR
VRK3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52617-CF
VRK3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52617-NF
VRK3 cDNA ORF Clone, Mouse, C-His tag MG52617-CH
VRK3 cDNA ORF Clone, Mouse, N-His tag MG52617-NH
VRK3 cDNA ORF Clone, Mouse, C-HA tag MG52617-CY
VRK3 cDNA ORF Clone, Mouse, N-HA tag MG52617-NY
VRK3 cDNA ORF Clone, Mouse, C-Myc tag MG52617-CM
VRK3 qPCR Primer Pairs, Mouse MP202488

VRK3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
VRK3 cDNA ORF Clone in Cloning Vector, Human HG25400-U
VRK3 cDNA ORF Clone, Human, untagged HG25400-UT
VRK3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG25400-ACGLN
VRK3 cDNA ORF Clone, Human, C-GFPSpark® tag HG25400-ACG
VRK3 cDNA ORF Clone, Human, N-GFPSpark® tag HG25400-ANG
VRK3 cDNA ORF Clone, Human, C-OFPSpark® tag HG25400-ACR
VRK3 cDNA ORF Clone, Human, N-OFPSpark® tag HG25400-ANR
VRK3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG25400-CF
VRK3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG25400-NF
VRK3 cDNA ORF Clone, Human, C-His tag HG25400-CH
VRK3 cDNA ORF Clone, Human, N-His tag HG25400-NH
VRK3 cDNA ORF Clone, Human, C-HA tag HG25400-CY
VRK3 cDNA ORF Clone, Human, N-HA tag HG25400-NY
VRK3 cDNA ORF Clone, Human, C-Myc tag HG25400-CM
VRK3 cDNA ORF Clone, Human, N-Myc tag HG25400-NM
info info
添加购物车成功! 添加购物车失败!