VPS26A cDNA ORF Clone, Mouse, C-His tag

Cat: MG52352-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All VPS26A Reagents
CRO Services
Product recommended

All VPS26A Reagents
VPS26A cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
984 bp
Description
Full length Clone DNA of Mouse vacuolar protein sorting 26 homolog A (yeast) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VPS26A cDNA ORF Clone, Mouse, C-His tag Alternative Names
AA407240 cDNA ORF Clone, Mouse;HB58 cDNA ORF Clone, Mouse;Vps26 cDNA ORF Clone, Mouse
VPS26A Background Information
Full Name
vacuolar protein sorting 26 homolog A (S. pombe)

VPS26A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
VPS26A cDNA ORF Clone in Cloning Vector, Mouse MG52352-U
VPS26A cDNA ORF Clone, Mouse, untagged MG52352-UT
VPS26A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52352-ACGLN
VPS26A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52352-ACG
VPS26A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52352-ANG
VPS26A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52352-ACR
VPS26A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52352-ANR
VPS26A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52352-CF
VPS26A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52352-NF
VPS26A cDNA ORF Clone, Mouse, N-His tag MG52352-NH
VPS26A cDNA ORF Clone, Mouse, C-HA tag MG52352-CY
VPS26A cDNA ORF Clone, Mouse, N-HA tag MG52352-NY
VPS26A cDNA ORF Clone, Mouse, C-Myc tag MG52352-CM
VPS26A cDNA ORF Clone, Mouse, N-Myc tag MG52352-NM
VPS26A qPCR Primer Pairs, Mouse MP202225

VPS26A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
VPS26A cDNA ORF Clone in Cloning Vector, Human HG16675-U
VPS26A cDNA ORF Clone, Human, untagged HG16675-UT
VPS26A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16675-ACGLN
VPS26A cDNA ORF Clone, Human, C-GFPSpark® tag HG16675-ACG
VPS26A cDNA ORF Clone, Human, N-GFPSpark® tag HG16675-ANG
VPS26A cDNA ORF Clone, Human, C-OFPSpark® tag HG16675-ACR
VPS26A cDNA ORF Clone, Human, N-OFPSpark® tag HG16675-ANR
VPS26A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16675-CF
VPS26A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16675-NF
VPS26A cDNA ORF Clone, Human, C-His tag HG16675-CH
VPS26A cDNA ORF Clone, Human, N-His tag HG16675-NH
VPS26A cDNA ORF Clone, Human, C-HA tag HG16675-CY
VPS26A cDNA ORF Clone, Human, N-HA tag HG16675-NY
VPS26A cDNA ORF Clone, Human, C-Myc tag HG16675-CM
VPS26A cDNA ORF Clone, Human, N-Myc tag HG16675-NM
info info
添加购物车成功! 添加购物车失败!